Antipoptotic protein BCL-2 inhibits autophagy 1-dependent.

The apoptosis and autophagy both regulate the biological processes that play a central role in network homeostasis, development, and disease. Anti-apoptotic protein, BCL-2, interact with evolutionary autophagy protein, beclin 1. However, a little known about the functional significance of this interaction. Here, we indicate that the antipoptotic protein BCL-2 wild type, but not binding 1 mutant that is damaged from BCL-2, inhibits autophagy 1-dependent in yeast and mammals and that BCL-2-transgenic expression of BCL-2 inhibits autophagy in the heart of the muscle.

Furthermore, Becklin 1 mutant that cannot bind BCL-2 pushes more autophagy than the type of wild Beck 1 and, unlike the type of wild Becker 1, promotes cell death. Thus, BCL-2 not only functions as an antipoptotic protein, but also as an antiautophagy protein through its inhibitory interaction with Becklin 1. This antiautophagy function of BCL-2 can help keep autophagy at a level compatible with cell survival, not death cells.

Identify the specific microrna network from the mouse.

Microrna (MIRNAS) is a new class of RNA not coded, which is encoded as a short reverse repetition in the invertebrate genome and vertebrate. It is believed that MIRNAS is a translation modulator and stability of the target MRNA, although most MRNAS targets remain identified. Here we describe identifying 34 mirnas novels with network-specific cloning around 21-nucleotides RNA from the mouse. Almost all MIRNAs identified are preserved in the human genome and are also often found in nonmamalia vertebrate genomes, such as pufferfish.

In the heart, heart, or brain, it was found that the Mirna expressed specifically the network dominated the MIRNA population expressed and showed the role for MIRNAs in network specifications or cell lineage decisions. Finally, Mirna was identified that seemed to be a fruit orthologist and Mammal C. Elegans Lin-4 Strna.

Micronas modulates the differentiation of hematopoietic lines.

Microrna (MIRNAS) is an abundant class of RNAS 22-nucleotide regulation found in plants and animals. Some MIRNAS plants, Elegans Caenorhabditis, and Drosophila played the role of important gene regulations during development with paired to target Mr.NNAS to determine posttransciptional repression from these messages. We identified three MIRNAs specifically expressed in hematopoietic cells and showed that their expressions were regulated dynamically during early hematopoiesis and commitment of lineage. One of the MIRNAs, MIR-181, especially stated in B-lymphoidal cells from the mouse bone marrow, and its ectopic expression in hematopoietic stem cells causes increased B cell-line cell fraction in both network culture differentiation tests. and adult mice. Our results indicate that Microrna is a component of the molecular circuit that controls the hematopoiesis mouse and suggests that other microrna has a similar regulatory role during other aspects of vertebrate developments.

Dystrophin: Protein products from Locus Dystrophy Muscle Duchenne.

Protein products from Dychenne Duchenne Locus Dystrophy (DMD) and homologous mouse (MDMD) have been identified using polyclonal antibodies directed towards fusion proteins containing two different regions of MDMD CDNA. DMD proteins are proven to be around 400 KD and to represent around 0.002% of the total lurik muscle protein. This protein is also detected in plain muscle (stomach).

Muscle tissue isolated from both boys affected by DMD and MDX mice do not contain DMD proteins detected, indicating that this genetic disorder is homologous. Because MDX mice present there are no clear clinical abnormalities, the identification of the MDX corpse as an animal model for DMD has important implications in connection with the deadly etiology of DMD phenotypes. We have named the dytrophin protein because of identification through the insulation of Duchenne muscle locus dystrophy.

Blood monocy consists of two main subsets with different migration properties.

Peripheral blood monocytes are heterogeneous leukocyte populations circulating. Using the Murine Adoption Transfer System to investigate Homing and Monocyte Differentiation in Vivo, we identify two functional parts of the Murine Blood Monocytes: CCR2 (LO) CR1 (+) which is short-lived (+) which is actively recruited for inflamed tissue and CCR (3) (hi) CCR1 (-) (-) subset (-) which is marked with CX (3) recruitment that depends on the CR1 on noninflamed networks. Both subsets have the potential to distinguish dendritic cells in in vivo.

pMD- 19T (Simple)
PVT0016	Lifescience Market	2 ug	EUR 266

Human MYC Associated Factor X (MAX) ELISA Kit
DLR-MAX-Hu-48T	DL Develop	48T	EUR 517
Should the Human MYC Associated Factor X (MAX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MYC Associated Factor X (MAX) in samples from tissue homogenates or other biological fluids.

Human MYC Associated Factor X (MAX) ELISA Kit
DLR-MAX-Hu-96T	DL Develop	96T	EUR 673
Should the Human MYC Associated Factor X (MAX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MYC Associated Factor X (MAX) in samples from tissue homogenates or other biological fluids.

Human MYC Associated Factor X (MAX) ELISA Kit
RD-MAX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human MYC Associated Factor X (MAX) ELISA Kit
RD-MAX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human MYC Associated Factor X (MAX) ELISA Kit
RDR-MAX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human MYC Associated Factor X (MAX) ELISA Kit
RDR-MAX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Po (P-Zero)
CH23009	Neuromics	100 ul	EUR 179

T1 Simple Cloning Kit
20-abx098056	Abbexa	EUR 495.00 EUR 662.00	20 rxns 60 rxns
Shipped within 5-10 working days.

Blunt Simple Cloning Kit
20-abx098060	Abbexa	EUR 495.00 EUR 662.00	20 rxns 60 rxns
Shipped within 5-10 working days.

pUC57 Simple-PVT1 Plasmid
PVTB00511	Lifescience Market	2 ug	EUR 356

pUC57 Simple-Pdcd4 Plasmid
PVTB70003	Lifescience Market	2 ug	EUR 356

pUC57- Simple- gRNA backbone
PVT11371	Lifescience Market	2 ug	EUR 301

Protein Max (MAX) Antibody
20-abx123505	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protein Max (MAX) Antibody
abx117235-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Protein Max (MAX) Antibody
20-abx001769	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Protein Max (Max) Antibody
abx146651-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Protein Max (MAX) Antibody
20-abx312892	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Max (MAX) Protein
20-abx260587	Abbexa	EUR 2861.00 EUR 328.00 EUR 230.00	1 mg 25 ug 5 ug
Shipped within 5-10 working days.

Protein Max (MAX) Antibody
abx431420-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Protein Max (MAX) Antibody
abx235033-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Jenner's Stain
GT5545-100G	Glentham Life Sciences	100 g	EUR 160

Jenner's Stain
GT5545-25G	Glentham Life Sciences	25 g	EUR 81

Giemsa Stain
GT6821-100ML	Glentham Life Sciences	100 ml	EUR 46

Giemsa Stain
GT6821-250ML	Glentham Life Sciences	250 ml	EUR 59

Wright's stain
GT7819-100G	Glentham Life Sciences	100 g	EUR 110

Wright's stain
GT7819-10G	Glentham Life Sciences	10 g	EUR 46

Wright's stain
GT7819-250G	Glentham Life Sciences	250 g	EUR 190

Wright's stain
GT7819-25G	Glentham Life Sciences	25 g	EUR 58

Giemsa stain
20-abx082069	Abbexa	EUR 175.00 EUR 217.00	1 g 5 g
Shipped within 5-10 working days.

Giemsa stain
20-abx082518	Abbexa	EUR 175.00 EUR 217.00	1 g 5 g
Shipped within 5-10 working days.

DiI Stain
B2742-250	Biovision	250 mg	EUR 753

DiI Stain
B2742-50	Biovision	50 mg	EUR 227

Giemsa stain
GB0477	Bio Basic	10g	EUR 60.44
Product category: Biochemicals/Indicators/Stains/Biological Stains

Fmoc-Ser(PO(OBzl)OH)-OH
B-3455.0001	Bachem	1.0g	EUR 297
Description: Sum Formula: C25H24NO8P; CAS# [158171-14-3]

Fmoc-Ser(PO(OBzl)OH)-OH
B-3455.0005	Bachem	5.0g	EUR 1093
Description: Sum Formula: C25H24NO8P; CAS# [158171-14-3]

Fmoc-Thr(PO(OBzl)OH)-OH
B-3460.0001	Bachem	1.0g	EUR 321
Description: Sum Formula: C26H26NO8P; CAS# [175291-56-2]

Fmoc-Thr(PO(OBzl)OH)-OH
B-3460.0005	Bachem	5.0g	EUR 1192
Description: Sum Formula: C26H26NO8P; CAS# [175291-56-2]

Fmoc-Tyr(PO(OBzl)OH)-OH
B-3565.0001	Bachem	1.0g	EUR 345
Description: Sum Formula: C31H28NO8P; CAS# [191348-16-0]

Fmoc-Tyr(PO(OBzl)OH)-OH
B-3565.0005	Bachem	5.0g	EUR 1288
Description: Sum Formula: C31H28NO8P; CAS# [191348-16-0]

Fish phenol oxidase (PO) ELISA Kit
QY-E160047	Qayee Biotechnology	96T	EUR 478

Protein Max (MAX) Antibody (HRP)
20-abx312893	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Max (MAX) Antibody (FITC)
20-abx312894	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Max (MAX) Antibody (Biotin)
20-abx312895	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Protein Stain-EZ C, Reversible Copper Stain Kit
BSP017	Bio Basic	1kit, 10prep	EUR 74.36
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Protein Stain-EZ B, Reversible Zinc Stain Kit
BSP019	Bio Basic	1kit, 10prep	EUR 74.36
Product category: Molecular Biology Kits/Protein - Staining

Protein Stain-EZG Rapid Coomassie Blue Stain Solution
BSP041	Bio Basic	1KIT, 10prep	EUR 76.1
Product category: Molecular Biology Kits/Protein - Staining

Fmoc-D-Tyr(PO(OBzl)OH)-OH
B-3795.0001	Bachem	1.0g	EUR 576
Description: Sum Formula: C31H28NO8P; CAS# [1926163-10-1]

Fmoc-D-Tyr(PO(OBzl)OH)-OH
B-3795.0005	Bachem	5.0g	EUR 2207
Description: Sum Formula: C31H28NO8P; CAS# [1926163-10-1]

Fmoc-D-Thr(PO(OBzl)OH)-OH
B-3800.0001	Bachem	1.0g	EUR 490
Description: Sum Formula: C26H26NO8P; CAS# [937171-63-6]

Fmoc-D-Thr(PO(OBzl)OH)-OH
B-3800.0005	Bachem	5.0g	EUR 1869
Description: Sum Formula: C26H26NO8P; CAS# [937171-63-6]

Fmoc-D-Ser(PO(OBzl)OH)-OH
B-3805.0001	Bachem	1.0g	EUR 515
Description: Sum Formula: C25H24NO8P; CAS# [1212481-01-0]

Fmoc-D-Ser(PO(OBzl)OH)-OH
B-3805.0005	Bachem	5.0g	EUR 1965
Description: Sum Formula: C25H24NO8P; CAS# [1212481-01-0]

Fmoc-L-Ser(PO(OBzl)OH)-OH
20-abx095044	Abbexa	EUR 258.00 EUR 1845.00 EUR 592.00	1 g 25 g 5 g
Shipped within 5-10 working days.

Fmoc-L-Thr(PO(Obzl)OH)-OH
20-abx095045	Abbexa	EUR 258.00 EUR 1845.00 EUR 592.00	1 g 25 g 5 g
Shipped within 5-10 working days.

Fmoc-L-Tyr(PO(Obzl)OH)-OH
20-abx095046	Abbexa	EUR 258.00 EUR 1845.00 EUR 592.00	1 g 25 g 5 g
Shipped within 5-10 working days.

Silver Stain kit
AR0171	BosterBio	1 kit (for 30 assays to stain the gel of 5 X8.5)	EUR 152

ClearSight DNA Stain
BH40501	Bioatlas	1ml	EUR 103
Description: For DNA staining and vizualization.

ClearSight RNA Stain
BH40601	Bioatlas	400µl	EUR 77
Description: For DNA staining and vizualization.

Reticulum Stain Kit
GRT-1	ScyTek Laboratories	1 kit(s)	EUR 255

Reticulum Stain Kit
GRT-2	ScyTek Laboratories	1 kit(s)	EUR 152

Gram Stain Kit
GSK-1	ScyTek Laboratories	125 ml ea.	EUR 125

Gram Stain Kit
GSK-2	ScyTek Laboratories	30 ml ea.	EUR 92

Gram Stain Kit
GSK-500	ScyTek Laboratories	500 ml ea.	EUR 303

Jenner's Stain, certified
GT1148-25G	Glentham Life Sciences	25 g	EUR 107

Giemsa stain, powder
GT7801-100G	Glentham Life Sciences	100 g	EUR 134

Giemsa stain, powder
GT7801-10G	Glentham Life Sciences	10 g	EUR 46

Giemsa stain, powder
GT7801-25G	Glentham Life Sciences	25 g	EUR 62

Giemsa stain, powder
GT7801-50G	Glentham Life Sciences	50 g	EUR 86

Giemsa stain, powder
GT7801-5G	Glentham Life Sciences	5 g	EUR 42

Fite's Stain Kit
FLS-1	ScyTek Laboratories	125 ml ea.	EUR 149

Fite's Stain Kit
FLS-500	ScyTek Laboratories	500 ml ea.	EUR 295

Iron Stain Kit
IRN-1	ScyTek Laboratories	1 kit(s)	EUR 149

Iron Stain Kit
IRN-2	ScyTek Laboratories	100 Slides	EUR 101

Fite's Stain Kit
K1425-125	Biovision		EUR 370

Geimsa Stain Kit
K1426-30	Biovision		EUR 289

Geimsa Stain Kit
K1426-500	Biovision		EUR 468

GMS Stain Kit
K1427-125	Biovision		EUR 446

Gram Stain Kit
k1428-125	Biovision		EUR 392

Gram Stain Kit
k1428-30	Biovision		EUR 262

Orcein Stain Kit
K1432-125	Biovision		EUR 501

Orcein Stain Kit
K1432-30	Biovision		EUR 359

Pneumocystis Stain Kit
K1434-125	Biovision		EUR 425

Pneumocystis Stain Kit
K1434-30	Biovision		EUR 316

Steiner Stain Kit
K1435-125	Biovision		EUR 446

Papanicolaou Stain Kit
K1440-30	Biovision		EUR 207

Papanicolaou Stain Kit
K1440-500	Biovision		EUR 278

Copper Stain Kit
CSK-1	ScyTek Laboratories	1 kit(s)	EUR 189

Copper Stain Kit
CSK-2	ScyTek Laboratories	1 kit(s)	EUR 120

GMS Stain Kit
KAA-1	ScyTek Laboratories	125 ml ea.	EUR 216

GMS Stain Kit
KAA-1000	ScyTek Laboratories	1000 ml ea.	EUR 884

GMS Stain Kit
KAA-500	ScyTek Laboratories	500 ml ea.	EUR 523

Pneumocystis Stain Kit
PCS-1	ScyTek Laboratories	1 kit(s)	EUR 156

Pneumocystis Stain Kit
PCS-2	ScyTek Laboratories	100 Slides	EUR 104

Trichrome Stain (Blue)
TGB125	ScyTek Laboratories	125 ml	EUR 74

Trichrome Stain (Blue)
TGB500	ScyTek Laboratories	500 ml	EUR 116

Trichrome Stain (Blue)
TGB999	ScyTek Laboratories	1000 ml	EUR 143

4CN Stain Kit
PW024	Bio Basic	5Preps, 5prep	EUR 70.88
Product category: Molecular Biology Kits/Protein - Staining

TMB Stain Kit
PW025	Bio Basic	5Preps, 5prep	EUR 70.88
Product category: Molecular Biology Kits/Protein - Staining

Chicken Protein max (MAX) ELISA Kit
abx512851-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Protein max (MAX) ELISA Kit
abx512853-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Rat Protein max (MAX) ELISA Kit
abx512854-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Human MAX/ Protein max ELISA Kit
E1557Hu	Sunlong	1 Kit	EUR 571

Human MAX(Protein max) ELISA Kit
EH0886	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Uniprot ID: P61244 Alias: MAX/BHLHD4(Protein max)/bHLHd5/bHLHd6/bHLHd7/bHLHd8/Class D basic helix-loop-helix protein 4/helix-loop-helix zipper protein/MAX protein/MYC associated factor X/Myc-associated factor X/orf1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Protein max (MAX) ELISA Kit
abx253842-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

MAX siRNA
20-abx923634	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAX siRNA
20-abx923635	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MAX antibody
70R-51297	Fitzgerald	100 ul	EUR 287
Description: Purified Polyclonal MAX antibody

MAX antibody
70R-36461	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal MAX antibody

MAX antibody
70R-8413	Fitzgerald	50 ug	EUR 467
Description: Affinity purified rabbit polyclonal MAX antibody

Max Antibody
ABD2438	Lifescience Market	100 ug	EUR 438

MAX Antibody
ABD6880	Lifescience Market	100 ug	EUR 438

MAX antibody
38388-100ul	SAB	100ul	EUR 252

MAX antibody
10R-1479	Fitzgerald	100 ug	EUR 512
Description: Mouse monoclonal MAX antibody

MAX antibody
20R-1191	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal MAX antibody

MAX antibody
70R-14305	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal MAX antibody

MAX Antibody
DF6880	Affbiotech	200ul	EUR 304
Description: MAX Antibody detects endogenous levels of total MAX.

Max Antibody
DF2438	Affbiotech	200ul	EUR 304
Description: Max antibody detects endogenous levels of total Max.

MAX Antibody
CSB-PA013527KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against MAX. Recognizes MAX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

MAX Antibody
CSB-PA013527KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against MAX. Recognizes MAX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

MAX Antibody
1-CSB-PA013527LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAX. Recognizes MAX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAX Antibody
1-CSB-PA010072	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAX. Recognizes MAX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

anti-MAX
YF-PA13071	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to MAX

ELISA kit for Rat Protein max (MAX)
KTE100655-48T	Abbkine	48T	EUR 332
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein max (MAX)
KTE100655-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein max (MAX)
KTE100655-96T	Abbkine	96T	EUR 539
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protein max (MAX)
KTE30121-48T	Abbkine	48T	EUR 354
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protein max (MAX)
KTE30121-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protein max (MAX)
KTE30121-96T	Abbkine	96T	EUR 572
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein max (MAX)
KTE61706-48T	Abbkine	48T	EUR 332
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Human Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein max (MAX)
KTE61706-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Human Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein max (MAX)
KTE61706-96T	Abbkine	96T	EUR 539
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Human Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein max (MAX)
KTE71108-48T	Abbkine	48T	EUR 332
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein max (MAX)
KTE71108-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein max (MAX)
KTE71108-96T	Abbkine	96T	EUR 539
MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Protein Stain-EZ A Ultra Sensitive Coomassie Blue Stain Solution
SK3011	Bio Basic	10Minigel, 10UNIT	EUR 66.53
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

InstaBlue Protein Stain Solution
B8226-1000	ApexBio	1 L	EUR 108
Description: InstaBlue Protein Stain Solution is a ready to use Coomassie protein stain for polyacrylamide gels. Its unique patented mechanism of action stains proteins in 5 minutes while leaving a clear background without the need to fix, wash or destain.

InstaBlue Protein Stain Solution
B8226-500	ApexBio	500 ml	EUR 84
Description: InstaBlue Protein Stain Solution is a ready to use Coomassie protein stain for polyacrylamide gels. Its unique patented mechanism of action stains proteins in 5 minutes while leaving a clear background without the need to fix, wash or destain.

Bielshowsky's Stain Kit (Modified)
BSK-1	ScyTek Laboratories	1 kit(s)	EUR 513

EA-50 Stain Solution
EAC3800	ScyTek Laboratories	1 Gal.	EUR 183

EA-50 Stain Solution
EAC500	ScyTek Laboratories	500 ml	EUR 88

EA-50 Stain Solution
EAC999	ScyTek Laboratories	1000 ml	EUR 111

EA-65 Stain Solution
EAD3800	ScyTek Laboratories	1 Gal.	EUR 154

EA-65 Stain Solution
EAD500	ScyTek Laboratories	500 ml	EUR 84

EA-65 Stain Solution
EAD999	ScyTek Laboratories	1000 ml	EUR 101

Giemsa stain, powder, certified
GT5290-100G	Glentham Life Sciences	100 g	EUR 178

Giemsa stain, powder, certified
GT5290-10G	Glentham Life Sciences	10 g	EUR 62

Giemsa stain, powder, certified
GT5290-25G	Glentham Life Sciences	25 g	EUR 86

Giemsa stain, powder, certified
GT5290-50G	Glentham Life Sciences	50 g	EUR 118

Giemsa stain, powder, certified
GT5290-5G	Glentham Life Sciences	5 g	EUR 50

EvaGreenFluorescent DNA Stain (100µM)
F253	GeneOn	1 ml	EUR 121

EvaGreenFluorescent DNA Stain (100µM)
F253L	GeneOn	5x1 ml	EUR 484

Modified Gram Stain Kit
K1429-125	Biovision		EUR 338

Modified Gram Stain Kit
K1429-30	Biovision		EUR 251

Warthin-Starry Stain Kit
K1437-125	Biovision		EUR 446

Wright-Giemsa Stain Kit
K1438-30	Biovision		EUR 262

Wright-Giemsa Stain Kit
K1438-500	Biovision		EUR 370

Colloidal Iron Stain Kit
CIK-1	ScyTek Laboratories	1 kit(s)	EUR 156

Colloidal Iron Stain Kit
CIK-2	ScyTek Laboratories	100 Slides	EUR 109

Papanicolaou (PAP) Stain Kit
PAP-1	ScyTek Laboratories	500 ml ea.	EUR 125

Papanicolaou (PAP) Stain Kit
PAP-2	ScyTek Laboratories	1 kit(s)	EUR 88

Papanicolaou (PAP) Stain Kit
PAP-3	ScyTek Laboratories	1000 ml ea.	EUR 200

101Bio Ponceau S Stain
P5W4	101Bio	NULL	EUR 0

Trichrome Stain Solution (Green)
TGG125	ScyTek Laboratories	125 ml	EUR 88

Trichrome Stain Solution (Green)
TGG500	ScyTek Laboratories	500 ml	EUR 116

Trichrome Stain Solution (Green)
TGG999	ScyTek Laboratories	1000 ml	EUR 143

SensitiveSafe DNA Gel Stain
W139-500	101Bio	NULL	EUR 0

Wright-Giemsa Stain Kit
WGK-1	ScyTek Laboratories	1 kit(s)	EUR 116

Wright-Giemsa Stain Kit
WGK-2	ScyTek Laboratories	1 kit(s)	EUR 84

Warthin-Starry Stain Kit
WSS-1	ScyTek Laboratories	1 kit(s)	EUR 183

India Ink Stain Solution
PW006	Bio Basic	100ml	EUR 74.36
Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Sensitive DAB Stain Kit
PW023	Bio Basic	5Preps, 5prep	EUR 69.14
Product category: Biochemicals/Indicators/Stains/Staining Kits

NBT/BCIP Stain Kit
PW032	Bio Basic	5Preps, 5prep	EUR 70.88
Product category: Molecular Biology Kits/Protein - Staining

INT/BCIP Stain Kit
PW033	Bio Basic	5Preps, 5prep	EUR 70.88
Product category: Molecular Biology Kits/Protein - Staining

MAX Conjugated Antibody
C38388	SAB	100ul	EUR 397

MAX cloning plasmid
CSB-CL013527HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 291 Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaaccgaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaagctcta Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid
CSB-CL013527HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 456 Sequence: atgagcgataacgatgacatcgaggtggagagcgacgctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccac Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid
CSB-CL013527HU3-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 405 Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaacagaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatc Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid
CSB-CL013527HU4-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 456 Sequence: atgagcgataacgatgacatcgaggtggagagcgacgctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccac Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid
CSB-CL013527HU5-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 483 Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaaccgaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatc Show more
Description: A cloning plasmid for the MAX gene.

anti- MAX antibody
FNab05033	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:200 Immunogen: MYC associated factor X Uniprot ID: P61244 Gene ID: 4149 Research Area: Epigenetics, Metabolism
Description: Antibody raised against MAX

Max Polyclonal Antibody
ES6195-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Max from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Max Polyclonal Antibody
ES6195-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Max from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

MAX (pS11) Antibody
20-abx000145	Abbexa	EUR 495.00 EUR 704.00 EUR 217.00 EUR 356.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Max Polyclonal Antibody
ABP55196-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from human Max around the non-phosphorylation site of S2 Applications tips:
Description: A polyclonal antibody for detection of Max from Human, Mouse, Rat. This Max antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Max around the non-phosphorylation site of S2

Max Polyclonal Antibody
ABP55196-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from human Max around the non-phosphorylation site of S2 Applications tips:
Description: A polyclonal antibody for detection of Max from Human, Mouse, Rat. This Max antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Max around the non-phosphorylation site of S2

The level of expression of CX (3) CR1 also defines two main human monocyte sets, CD14 (+) CD16 (-) and CD14 (LO) monocytes, which share the potential for phenotypes and homing with the mouse set. These findings raise the potential of new therapeutic strategies in inflammatory diseases.