Antipoptotic protein BCL-2 inhibits autophagy 1-dependent.

Antipoptotic protein BCL-2 inhibits autophagy 1-dependent.

The apoptosis and autophagy both regulate the biological processes that play a central role in network homeostasis, development, and disease. Anti-apoptotic protein, BCL-2, interact with evolutionary autophagy protein, beclin 1. However, a little known about the functional significance of this interaction. Here, we indicate that the antipoptotic protein BCL-2 wild type, but not binding 1 mutant that is damaged from BCL-2, inhibits autophagy 1-dependent in yeast and mammals and that BCL-2-transgenic expression of BCL-2 inhibits autophagy in the heart of the muscle.

Furthermore, Becklin 1 mutant that cannot bind BCL-2 pushes more autophagy than the type of wild Beck 1 and, unlike the type of wild Becker 1, promotes cell death. Thus, BCL-2 not only functions as an antipoptotic protein, but also as an antiautophagy protein through its inhibitory interaction with Becklin 1. This antiautophagy function of BCL-2 can help keep autophagy at a level compatible with cell survival, not death cells.

Identify the specific microrna network from the mouse.

Microrna (MIRNAS) is a new class of RNA not coded, which is encoded as a short reverse repetition in the invertebrate genome and vertebrate. It is believed that MIRNAS is a translation modulator and stability of the target MRNA, although most MRNAS targets remain identified. Here we describe identifying 34 mirnas novels with network-specific cloning around 21-nucleotides RNA from the mouse. Almost all MIRNAs identified are preserved in the human genome and are also often found in nonmamalia vertebrate genomes, such as pufferfish.

In the heart, heart, or brain, it was found that the Mirna expressed specifically the network dominated the MIRNA population expressed and showed the role for MIRNAs in network specifications or cell lineage decisions. Finally, Mirna was identified that seemed to be a fruit orthologist and Mammal C. Elegans Lin-4 Strna.

Micronas modulates the differentiation of hematopoietic lines.

Microrna (MIRNAS) is an abundant class of RNAS 22-nucleotide regulation found in plants and animals. Some MIRNAS plants, Elegans Caenorhabditis, and Drosophila played the role of important gene regulations during development with paired to target Mr.NNAS to determine posttransciptional repression from these messages. We identified three MIRNAs specifically expressed in hematopoietic cells and showed that their expressions were regulated dynamically during early hematopoiesis and commitment of lineage. One of the MIRNAs, MIR-181, especially stated in B-lymphoidal cells from the mouse bone marrow, and its ectopic expression in hematopoietic stem cells causes increased B cell-line cell fraction in both network culture differentiation tests. and adult mice. Our results indicate that Microrna is a component of the molecular circuit that controls the hematopoiesis mouse and suggests that other microrna has a similar regulatory role during other aspects of vertebrate developments.

Dystrophin: Protein products from Locus Dystrophy Muscle Duchenne.

Protein products from Dychenne Duchenne Locus Dystrophy (DMD) and homologous mouse (MDMD) have been identified using polyclonal antibodies directed towards fusion proteins containing two different regions of MDMD CDNA. DMD proteins are proven to be around 400 KD and to represent around 0.002% of the total lurik muscle protein. This protein is also detected in plain muscle (stomach).

Muscle tissue isolated from both boys affected by DMD and MDX mice do not contain DMD proteins detected, indicating that this genetic disorder is homologous. Because MDX mice present there are no clear clinical abnormalities, the identification of the MDX corpse as an animal model for DMD has important implications in connection with the deadly etiology of DMD phenotypes. We have named the dytrophin protein because of identification through the insulation of Duchenne muscle locus dystrophy.

Antipoptotic protein BCL-2 inhibits autophagy 1-dependent.

Blood monocy consists of two main subsets with different migration properties.

Peripheral blood monocytes are heterogeneous leukocyte populations circulating. Using the Murine Adoption Transfer System to investigate Homing and Monocyte Differentiation in Vivo, we identify two functional parts of the Murine Blood Monocytes: CCR2 (LO) CR1 (+) which is short-lived (+) which is actively recruited for inflamed tissue and CCR (3) (hi) CCR1 (-) (-) subset (-) which is marked with CX (3) recruitment that depends on the CR1 on noninflamed networks. Both subsets have the potential to distinguish dendritic cells in in vivo.

pMD- 19T (Simple)

PVT0016 2 ug
EUR 266

Human MYC Associated Factor X (MAX) ELISA Kit

DLR-MAX-Hu-48T 48T
EUR 517
  • Should the Human MYC Associated Factor X (MAX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MYC Associated Factor X (MAX) in samples from tissue homogenates or other biological fluids.

Human MYC Associated Factor X (MAX) ELISA Kit

DLR-MAX-Hu-96T 96T
EUR 673
  • Should the Human MYC Associated Factor X (MAX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human MYC Associated Factor X (MAX) in samples from tissue homogenates or other biological fluids.

Human MYC Associated Factor X (MAX) ELISA Kit

RD-MAX-Hu-48Tests 48 Tests
EUR 521

Human MYC Associated Factor X (MAX) ELISA Kit

RD-MAX-Hu-96Tests 96 Tests
EUR 723

Human MYC Associated Factor X (MAX) ELISA Kit

RDR-MAX-Hu-48Tests 48 Tests
EUR 544

Human MYC Associated Factor X (MAX) ELISA Kit

RDR-MAX-Hu-96Tests 96 Tests
EUR 756

Po (P-Zero)

CH23009 100 ul
EUR 179

T1 Simple Cloning Kit

20-abx098056
  • EUR 495.00
  • EUR 662.00
  • 20 rxns
  • 60 rxns
  • Shipped within 5-10 working days.

Blunt Simple Cloning Kit

20-abx098060
  • EUR 495.00
  • EUR 662.00
  • 20 rxns
  • 60 rxns
  • Shipped within 5-10 working days.

pUC57 Simple-PVT1 Plasmid

PVTB00511 2 ug
EUR 356

pUC57 Simple-Pdcd4 Plasmid

PVTB70003 2 ug
EUR 356

pUC57- Simple- gRNA backbone

PVT11371 2 ug
EUR 301

Protein Max (MAX) Antibody

20-abx123505
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Max (MAX) Antibody

abx117235-100ug 100 ug
EUR 467
  • Shipped within 5-10 working days.

Protein Max (MAX) Antibody

20-abx001769
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Protein Max (Max) Antibody

abx146651-100ug 100 ug
EUR 439
  • Shipped within 5-10 working days.

Protein Max (MAX) Antibody

20-abx312892
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Max (MAX) Protein

20-abx260587
  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Protein Max (MAX) Antibody

abx431420-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Protein Max (MAX) Antibody

abx235033-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Jenner's Stain

GT5545-100G 100 g
EUR 160

Jenner's Stain

GT5545-25G 25 g
EUR 81

Giemsa Stain

GT6821-100ML 100 ml
EUR 46

Giemsa Stain

GT6821-250ML 250 ml
EUR 59

Wright's stain

GT7819-100G 100 g
EUR 110

Wright's stain

GT7819-10G 10 g
EUR 46

Wright's stain

GT7819-250G 250 g
EUR 190

Wright's stain

GT7819-25G 25 g
EUR 58

Giemsa stain

20-abx082069
  • EUR 175.00
  • EUR 217.00
  • 1 g
  • 5 g
  • Shipped within 5-10 working days.

Giemsa stain

20-abx082518
  • EUR 175.00
  • EUR 217.00
  • 1 g
  • 5 g
  • Shipped within 5-10 working days.

DiI Stain

B2742-250 250 mg
EUR 753

DiI Stain

B2742-50 50 mg
EUR 227

Giemsa stain

GB0477 10g
EUR 60.44
  • Product category: Biochemicals/Indicators/Stains/Biological Stains

Fmoc-Ser(PO(OBzl)OH)-OH

B-3455.0001 1.0g
EUR 297
Description: Sum Formula: C25H24NO8P; CAS# [158171-14-3]

Fmoc-Ser(PO(OBzl)OH)-OH

B-3455.0005 5.0g
EUR 1093
Description: Sum Formula: C25H24NO8P; CAS# [158171-14-3]

Fmoc-Thr(PO(OBzl)OH)-OH

B-3460.0001 1.0g
EUR 321
Description: Sum Formula: C26H26NO8P; CAS# [175291-56-2]

Fmoc-Thr(PO(OBzl)OH)-OH

B-3460.0005 5.0g
EUR 1192
Description: Sum Formula: C26H26NO8P; CAS# [175291-56-2]

Fmoc-Tyr(PO(OBzl)OH)-OH

B-3565.0001 1.0g
EUR 345
Description: Sum Formula: C31H28NO8P; CAS# [191348-16-0]

Fmoc-Tyr(PO(OBzl)OH)-OH

B-3565.0005 5.0g
EUR 1288
Description: Sum Formula: C31H28NO8P; CAS# [191348-16-0]

Fish phenol oxidase (PO) ELISA Kit

QY-E160047 96T
EUR 478

Protein Max (MAX) Antibody (HRP)

20-abx312893
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Max (MAX) Antibody (FITC)

20-abx312894
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Max (MAX) Antibody (Biotin)

20-abx312895
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Protein Stain-EZ C, Reversible Copper Stain Kit

BSP017 1kit, 10prep
EUR 74.36
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Protein Stain-EZ B, Reversible Zinc Stain Kit

BSP019 1kit, 10prep
EUR 74.36
  • Product category: Molecular Biology Kits/Protein - Staining

Protein Stain-EZG Rapid Coomassie Blue Stain Solution

BSP041 1KIT, 10prep
EUR 76.1
  • Product category: Molecular Biology Kits/Protein - Staining

Fmoc-D-Tyr(PO(OBzl)OH)-OH

B-3795.0001 1.0g
EUR 576
Description: Sum Formula: C31H28NO8P; CAS# [1926163-10-1]

Fmoc-D-Tyr(PO(OBzl)OH)-OH

B-3795.0005 5.0g
EUR 2207
Description: Sum Formula: C31H28NO8P; CAS# [1926163-10-1]

Fmoc-D-Thr(PO(OBzl)OH)-OH

B-3800.0001 1.0g
EUR 490
Description: Sum Formula: C26H26NO8P; CAS# [937171-63-6]

Fmoc-D-Thr(PO(OBzl)OH)-OH

B-3800.0005 5.0g
EUR 1869
Description: Sum Formula: C26H26NO8P; CAS# [937171-63-6]

Fmoc-D-Ser(PO(OBzl)OH)-OH

B-3805.0001 1.0g
EUR 515
Description: Sum Formula: C25H24NO8P; CAS# [1212481-01-0]

Fmoc-D-Ser(PO(OBzl)OH)-OH

B-3805.0005 5.0g
EUR 1965
Description: Sum Formula: C25H24NO8P; CAS# [1212481-01-0]

Fmoc-L-Ser(PO(OBzl)OH)-OH

20-abx095044
  • EUR 258.00
  • EUR 1845.00
  • EUR 592.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 5-10 working days.

Fmoc-L-Thr(PO(Obzl)OH)-OH

20-abx095045
  • EUR 258.00
  • EUR 1845.00
  • EUR 592.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 5-10 working days.

Fmoc-L-Tyr(PO(Obzl)OH)-OH

20-abx095046
  • EUR 258.00
  • EUR 1845.00
  • EUR 592.00
  • 1 g
  • 25 g
  • 5 g
  • Shipped within 5-10 working days.

Silver Stain kit

AR0171 1 kit (for 30 assays to stain the gel of 5 X8.5)
EUR 152

ClearSight DNA Stain

BH40501 1ml
EUR 103
Description: For DNA staining and vizualization.

ClearSight RNA Stain

BH40601 400µl
EUR 77
Description: For DNA staining and vizualization.

Reticulum Stain Kit

GRT-1 1 kit(s)
EUR 255

Reticulum Stain Kit

GRT-2 1 kit(s)
EUR 152

Gram Stain Kit

GSK-1 125 ml ea.
EUR 125

Gram Stain Kit

GSK-2 30 ml ea.
EUR 92

Gram Stain Kit

GSK-500 500 ml ea.
EUR 303

Jenner's Stain, certified

GT1148-25G 25 g
EUR 107

Giemsa stain, powder

GT7801-100G 100 g
EUR 134

Giemsa stain, powder

GT7801-10G 10 g
EUR 46

Giemsa stain, powder

GT7801-25G 25 g
EUR 62

Giemsa stain, powder

GT7801-50G 50 g
EUR 86

Giemsa stain, powder

GT7801-5G 5 g
EUR 42

Fite's Stain Kit

FLS-1 125 ml ea.
EUR 149

Fite's Stain Kit

FLS-500 500 ml ea.
EUR 295

Iron Stain Kit

IRN-1 1 kit(s)
EUR 149

Iron Stain Kit

IRN-2 100 Slides
EUR 101

Fite's Stain Kit

K1425-125
EUR 370

Geimsa Stain Kit

K1426-30
EUR 289

Geimsa Stain Kit

K1426-500
EUR 468

GMS Stain Kit

K1427-125
EUR 446

Gram Stain Kit

k1428-125
EUR 392

Gram Stain Kit

k1428-30
EUR 262

Orcein Stain Kit

K1432-125
EUR 501

Orcein Stain Kit

K1432-30
EUR 359

Pneumocystis Stain Kit

K1434-125
EUR 425

Pneumocystis Stain Kit

K1434-30
EUR 316

Steiner Stain Kit

K1435-125
EUR 446

Papanicolaou Stain Kit

K1440-30
EUR 207

Papanicolaou Stain Kit

K1440-500
EUR 278

Copper Stain Kit

CSK-1 1 kit(s)
EUR 189

Copper Stain Kit

CSK-2 1 kit(s)
EUR 120

GMS Stain Kit

KAA-1 125 ml ea.
EUR 216

GMS Stain Kit

KAA-1000 1000 ml ea.
EUR 884

GMS Stain Kit

KAA-500 500 ml ea.
EUR 523

Pneumocystis Stain Kit

PCS-1 1 kit(s)
EUR 156

Pneumocystis Stain Kit

PCS-2 100 Slides
EUR 104

Trichrome Stain (Blue)

TGB125 125 ml
EUR 74

Trichrome Stain (Blue)

TGB500 500 ml
EUR 116

Trichrome Stain (Blue)

TGB999 1000 ml
EUR 143

4CN Stain Kit

PW024 5Preps, 5prep
EUR 70.88
  • Product category: Molecular Biology Kits/Protein - Staining

TMB Stain Kit

PW025 5Preps, 5prep
EUR 70.88
  • Product category: Molecular Biology Kits/Protein - Staining

Chicken Protein max (MAX) ELISA Kit

abx512851-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Protein max (MAX) ELISA Kit

abx512853-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Protein max (MAX) ELISA Kit

abx512854-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human MAX/ Protein max ELISA Kit

E1557Hu 1 Kit
EUR 571

Human MAX(Protein max) ELISA Kit

EH0886 96T
EUR 567.6
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: P61244
  • Alias: MAX/BHLHD4(Protein max)/bHLHd5/bHLHd6/bHLHd7/bHLHd8/Class D basic helix-loop-helix protein 4/helix-loop-helix zipper protein/MAX protein/MYC associated factor X/Myc-associated factor X/orf1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Protein max (MAX) ELISA Kit

abx253842-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

MAX siRNA

20-abx923634
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAX siRNA

20-abx923635
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MAX antibody

70R-51297 100 ul
EUR 287
Description: Purified Polyclonal MAX antibody

MAX antibody

70R-36461 100 ug
EUR 327
Description: Rabbit polyclonal MAX antibody

MAX antibody

70R-8413 50 ug
EUR 467
Description: Affinity purified rabbit polyclonal MAX antibody

Max Antibody

ABD2438 100 ug
EUR 438

MAX Antibody

ABD6880 100 ug
EUR 438

MAX antibody

38388-100ul 100ul
EUR 252

MAX antibody

10R-1479 100 ug
EUR 512
Description: Mouse monoclonal MAX antibody

MAX antibody

20R-1191 100 ug
EUR 377
Description: Rabbit polyclonal MAX antibody

MAX antibody

70R-14305 100 ug
EUR 322
Description: Affinity purified Rabbit polyclonal MAX antibody

MAX Antibody

DF6880 200ul
EUR 304
Description: MAX Antibody detects endogenous levels of total MAX.

Max Antibody

DF2438 200ul
EUR 304
Description: Max antibody detects endogenous levels of total Max.

MAX Antibody

CSB-PA013527KA01HU-
EUR 335
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against MAX. Recognizes MAX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

MAX Antibody

CSB-PA013527KA01HU-100ul 100ul
EUR 389
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against MAX. Recognizes MAX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

MAX Antibody

1-CSB-PA013527LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MAX. Recognizes MAX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

MAX Antibody

1-CSB-PA010072
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against MAX. Recognizes MAX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/10000

anti-MAX

YF-PA13071 100 ug
EUR 403
Description: Rabbit polyclonal to MAX

ELISA kit for Rat Protein max (MAX)

KTE100655-48T 48T
EUR 332
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein max (MAX)

KTE100655-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Protein max (MAX)

KTE100655-96T 96T
EUR 539
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protein max (MAX)

KTE30121-48T 48T
EUR 354
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protein max (MAX)

KTE30121-5platesof96wells 5 plates of 96 wells
EUR 2252
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Protein max (MAX)

KTE30121-96T 96T
EUR 572
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein max (MAX)

KTE61706-48T 48T
EUR 332
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein max (MAX)

KTE61706-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein max (MAX)

KTE61706-96T 96T
EUR 539
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein max (MAX)

KTE71108-48T 48T
EUR 332
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein max (MAX)

KTE71108-5platesof96wells 5 plates of 96 wells
EUR 2115
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Protein max (MAX)

KTE71108-96T 96T
EUR 539
  • MAX is a member of the basic helix-loop-helix leucine zipper (bHLHZ) family of transcription factors. It is able to form homodimers and heterodimers with other family members, which include Mad, Mxi1 and Myc. Myc is an oncoprotein implicated in cell
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Protein max (MAX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Protein Stain-EZ A Ultra Sensitive Coomassie Blue Stain Solution

SK3011 10Minigel, 10UNIT
EUR 66.53
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

InstaBlue Protein Stain Solution

B8226-1000 1 L
EUR 108
Description: InstaBlue Protein Stain Solution is a ready to use Coomassie protein stain for polyacrylamide gels. Its unique patented mechanism of action stains proteins in 5 minutes while leaving a clear background without the need to fix, wash or destain.

InstaBlue Protein Stain Solution

B8226-500 500 ml
EUR 84
Description: InstaBlue Protein Stain Solution is a ready to use Coomassie protein stain for polyacrylamide gels. Its unique patented mechanism of action stains proteins in 5 minutes while leaving a clear background without the need to fix, wash or destain.

Bielshowsky's Stain Kit (Modified)

BSK-1 1 kit(s)
EUR 513

EA-50 Stain Solution

EAC3800 1 Gal.
EUR 183

EA-50 Stain Solution

EAC500 500 ml
EUR 88

EA-50 Stain Solution

EAC999 1000 ml
EUR 111

EA-65 Stain Solution

EAD3800 1 Gal.
EUR 154

EA-65 Stain Solution

EAD500 500 ml
EUR 84

EA-65 Stain Solution

EAD999 1000 ml
EUR 101

Giemsa stain, powder, certified

GT5290-100G 100 g
EUR 178

Giemsa stain, powder, certified

GT5290-10G 10 g
EUR 62

Giemsa stain, powder, certified

GT5290-25G 25 g
EUR 86

Giemsa stain, powder, certified

GT5290-50G 50 g
EUR 118

Giemsa stain, powder, certified

GT5290-5G 5 g
EUR 50

EvaGreenFluorescent DNA Stain (100µM)

F253 1 ml
EUR 121

EvaGreenFluorescent DNA Stain (100µM)

F253L 5x1 ml
EUR 484

Modified Gram Stain Kit

K1429-125
EUR 338

Modified Gram Stain Kit

K1429-30
EUR 251

Warthin-Starry Stain Kit

K1437-125
EUR 446

Wright-Giemsa Stain Kit

K1438-30
EUR 262

Wright-Giemsa Stain Kit

K1438-500
EUR 370

Colloidal Iron Stain Kit

CIK-1 1 kit(s)
EUR 156

Colloidal Iron Stain Kit

CIK-2 100 Slides
EUR 109

Papanicolaou (PAP) Stain Kit

PAP-1 500 ml ea.
EUR 125

Papanicolaou (PAP) Stain Kit

PAP-2 1 kit(s)
EUR 88

Papanicolaou (PAP) Stain Kit

PAP-3 1000 ml ea.
EUR 200

101Bio Ponceau S Stain

P5W4 NULL
EUR 0

Trichrome Stain Solution (Green)

TGG125 125 ml
EUR 88

Trichrome Stain Solution (Green)

TGG500 500 ml
EUR 116

Trichrome Stain Solution (Green)

TGG999 1000 ml
EUR 143

SensitiveSafe DNA Gel Stain

W139-500 NULL
EUR 0

Wright-Giemsa Stain Kit

WGK-1 1 kit(s)
EUR 116

Wright-Giemsa Stain Kit

WGK-2 1 kit(s)
EUR 84

Warthin-Starry Stain Kit

WSS-1 1 kit(s)
EUR 183

India Ink Stain Solution

PW006 100ml
EUR 74.36
  • Product category: Biochemicals/Indicators/Stains/Peptide/Protein Related

Sensitive DAB Stain Kit

PW023 5Preps, 5prep
EUR 69.14
  • Product category: Biochemicals/Indicators/Stains/Staining Kits

NBT/BCIP Stain Kit

PW032 5Preps, 5prep
EUR 70.88
  • Product category: Molecular Biology Kits/Protein - Staining

INT/BCIP Stain Kit

PW033 5Preps, 5prep
EUR 70.88
  • Product category: Molecular Biology Kits/Protein - Staining

MAX Conjugated Antibody

C38388 100ul
EUR 397

MAX cloning plasmid

CSB-CL013527HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 291
  • Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaaccgaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaagctcta
  • Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid

CSB-CL013527HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgagcgataacgatgacatcgaggtggagagcgacgctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccac
  • Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid

CSB-CL013527HU3-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 405
  • Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaacagaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatc
  • Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid

CSB-CL013527HU4-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 456
  • Sequence: atgagcgataacgatgacatcgaggtggagagcgacgctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccac
  • Show more
Description: A cloning plasmid for the MAX gene.

MAX cloning plasmid

CSB-CL013527HU5-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 483
  • Sequence: atgagcgataacgatgacatcgaggtggagagcgacgaagagcaaccgaggtttcaatctgcggctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatc
  • Show more
Description: A cloning plasmid for the MAX gene.

anti- MAX antibody

FNab05033 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • IF: 1:50 - 1:200
  • Immunogen: MYC associated factor X
  • Uniprot ID: P61244
  • Gene ID: 4149
  • Research Area: Epigenetics, Metabolism
Description: Antibody raised against MAX

Max Polyclonal Antibody

ES6195-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Max from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

Max Polyclonal Antibody

ES6195-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Max from Human/Mouse/Rat. This antibody is tested and validated for IHC, WB, ELISA

MAX (pS11) Antibody

20-abx000145
  • EUR 495.00
  • EUR 704.00
  • EUR 217.00
  • EUR 356.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Max Polyclonal Antibody

ABP55196-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human Max around the non-phosphorylation site of S2
  • Applications tips:
Description: A polyclonal antibody for detection of Max from Human, Mouse, Rat. This Max antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Max around the non-phosphorylation site of S2

Max Polyclonal Antibody

ABP55196-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from human Max around the non-phosphorylation site of S2
  • Applications tips:
Description: A polyclonal antibody for detection of Max from Human, Mouse, Rat. This Max antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human Max around the non-phosphorylation site of S2

The level of expression of CX (3) CR1 also defines two main human monocyte sets, CD14 (+) CD16 (-) and CD14 (LO) monocytes, which share the potential for phenotypes and homing with the mouse set. These findings raise the potential of new therapeutic strategies in inflammatory diseases.

 

Leave a Reply

Your email address will not be published. Required fields are marked *