Tissue Tek Oct Compound Sms

Lab Reagents

Human IgG antibody Laboratories manufactures the tissue tek oct compound sms reagents distributed by Genprice. The Tissue Tek Oct Compound Sms reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact tissue tek compound. Other Tissue products are available in stock. Specificity: Tissue Category: Tek Group: Oct Compound

Oct Compound information

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Hu-96Tests 96 Tests
EUR 724

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Ra-48Tests 48 Tests
EUR 558

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Ra-96Tests 96 Tests
EUR 776

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-b-48Tests 48 Tests
EUR 580

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-b-96Tests 96 Tests
EUR 807

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Hu-48Tests 48 Tests
EUR 500

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Hu-96Tests 96 Tests
EUR 692

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Ra-48Tests 48 Tests
EUR 534

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Ra-96Tests 96 Tests
EUR 742

SMS antibody

70R-20408 50 ul
EUR 435
Description: Rabbit polyclonal SMS antibody

SMS Antibody

47247-100ul 100ul
EUR 252

SMS antibody

10R-5833 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-5834 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-5835 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-5836 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-5837 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-5839 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-7188 100 ul
EUR 726
Description: Mouse monoclonal SMS antibody

SMS antibody

10R-7189 100 ul
EUR 691
Description: Mouse monoclonal SMS antibody

SMS Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SMS. Recognizes SMS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

SMS Antibody

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMS. Recognizes SMS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Compound W

EUR 300

Compound W

EUR 115

Compound 112254

EUR 588

Compound 112254

EUR 185

Compound 401

EUR 238

Compound 1

EUR 207

Compound 34

EUR 457

Compound 34

EUR 158

Compound E

EUR 370

Compound E

EUR 153

Compound CL0485

ADC-P-074 unit Ask for price

Compound 401

B7337-10 10 mg
EUR 224

Compound 401

B7337-25 25 mg
EUR 441

Compound 401

B7337-5 5 mg
EUR 180

Compound W

A4401-50 50 mg
EUR 177
Description: Inhibitor of ?-secretase; causes a decrease in the released levels of A?42 and notch-1 A?-like peptide 25 (N?25).

Compound 56

A8197-.5 500 µg
EUR 108
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56

A8197-5 5 mg
EUR 224
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56

A8197-5.1 10 mM (in 1mL DMSO)
EUR 270
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56

A8197-S Evaluation Sample
EUR 81
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound E

HY-14176 10mM/1mL
EUR 694

Compound 401

HY-19341 10mM/1mL
EUR 186

Compound 34

GL2080-1MG 1 mg
EUR 373

Compound 34

GL2080-200UG 200 ug
EUR 166

Compound 112254

GL3740-10MG 10 mg
EUR 166

Compound 112254

GL3740-50MG 50 mg
EUR 459

Compound E

GL3746-1MG 1 mg
EUR 378

Compound E

GL3746-250UG 250 ug
EUR 172

Compound E

GL3746-5MG 5 mg
EUR 998

Compound 2

HY-U00358 10mg
EUR 6041

Compound K

N1890-20 20 mg
EUR 340
Description: Compound K

Imidazoquinoline Compound

VAdv-Ly0028 5 mg
EUR 3280
Description: Imidazoquinoline compound, a TLR7 agonist vaccine adjuvant.

TEK antibody

70R-20759 50 ul
EUR 435
Description: Rabbit polyclonal TEK antibody

TEK Antibody

37274-100ul 100ul
EUR 252

TEK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

TEK Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TEK Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEK Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TEK Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


YF-PA27377 50 ug
EUR 363
Description: Mouse polyclonal to TEK

SMS Conjugated Antibody

C47247 100ul
EUR 397

SMS cloning plasmid

CSB-CL021854HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1101
  • Sequence: atggcagcagcacggcacagcacgctcgacttcatgctcggcgccaaagctgatggtgagaccattctaaaaggcctccagtccattttccaggagcaggggatggcggagtcggtgcacacctggcaggaccatggctatttagcaacctacacaaacaagaacggcagctttg
  • Show more
Description: A cloning plasmid for the SMS gene.

SMS Rabbit pAb

A9154-100ul 100 ul
EUR 308

SMS Rabbit pAb

A9154-200ul 200 ul
EUR 459

SMS Rabbit pAb

A9154-20ul 20 ul
EUR 183

SMS Rabbit pAb

A9154-50ul 50 ul
EUR 223

Anti-SMS antibody

STJ111588 100 µl
EUR 277
Description: This gene encodes a protein belonging to the spermidine/spermin synthase family. Pseudogenes of this gene are located on chromosomes 1, 5, 6 and X. Mutations in this gene are associated with X-linked Snyder-Robinson mental retardation syndrome. Multiple transcript variants encoding different isoforms have been found for this gene.

Dorsomorphin (Compound C)

B3252-10 10 mg
EUR 137
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Dorsomorphin (Compound C)

B3252-5 5 mg
EUR 108
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Dorsomorphin (Compound C)

B3252-50 50 mg
EUR 340
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Teijin compound 1

B5468-10 10 mg
EUR 389

Teijin compound 1

B5468-50 50 mg
EUR 1476

GPR120 Compound A

C5824-10 10 mg
EUR 293
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

GPR120 Compound A

C5824-5 5 mg
EUR 197
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

GPR120 Compound A

C5824-50 50 mg
EUR 920
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

Antibacterial compound 2

HY-101730 5mg
EUR 7984

Antibacterial compound 1

HY-101819 5mg
EUR 2198

Teijin compound 1

HY-108323 5mg
EUR 312

Compound 112254 hydrochloride

GL8859-10MG 10 mg
EUR 166

Compound 112254 hydrochloride

GL8859-50MG 50 mg
EUR 459

Antiasthmatic Compound 1

HY-U00409 1mg
EUR 849

APHA Compound 8

M45003 1 mg
EUR 284.9
Description: Ask the seller for details

Mucicarmine Stain Kit (Modified Southgate's)

SMS-1 1 kit(s)
EUR 159

Mucicarmine Stain Kit (Modified Southgate's)

SMS-2 100 Slides
EUR 104

Oct 1 antibody

20R-1517 100 ug
EUR 673
Description: Rabbit polyclonal Oct 1 antibody

Oct 2 antibody

20R-1652 100 ug
EUR 673
Description: Rabbit polyclonal Oct 2 antibody

Oct 4 antibody

20R-1653 100 ug
EUR 673
Description: Rabbit polyclonal Oct 4 antibody

OCT-4 Antibody

21424-100ul 100ul
EUR 252

OCT-4 Antibody

21424-50ul 50ul
EUR 187

Oct-1 Antibody

21674-100ul 100ul
EUR 252

Oct-1 Antibody

21674-50ul 50ul
EUR 187

Oct-1 Antibody

EUR 316

Oct-1 Antibody

EUR 146

Oct-2 Antibody

EUR 338

Oct-2 Antibody

EUR 146

Oct-4 Antibody

EUR 441

Oct-4 Antibody

EUR 146

Oct-1 Antibody

49901-100ul 100ul
EUR 333

Oct-1 Antibody

49901-50ul 50ul
EUR 239

Oct-6 Antibody

44376-100ul 100ul
EUR 252

Oct-6 Antibody

44376-50ul 50ul
EUR 187

Oct-6 Antibody

AF9136 200ul
EUR 304
Description: Oct-6 Antibody detects endogenous levels of total Oct-6.

Oct- 6 Antibody

ABF9136 100 ug
EUR 438


MO47035 100 ul
EUR 349

SMS protein (His tag)

80R-2100 50 ug
EUR 424
Description: Recombinant human SMS protein (His tag)

Spermine Synthase (SMS) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Spermine Synthase (SMS) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.


EF005602 96 Tests
EUR 689

Mouse SMS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SMS Antibody, HRP conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMS. Recognizes SMS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SMS Antibody, FITC conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMS. Recognizes SMS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SMS Antibody, Biotin conjugated

  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SMS. Recognizes SMS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Spermine Synthase (SMS) Antibody

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human SMS shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SMS Recombinant Protein (Rat)

RP230159 100 ug Ask for price

Recombinant Spermine Synthase (SMS)

  • EUR 440.48
  • EUR 221.00
  • EUR 1376.80
  • EUR 525.60
  • EUR 951.20
  • EUR 358.00
  • EUR 3292.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P52788
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.8kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Spermine Synthase expressed in: E.coli

SMS Recombinant Protein (Human)

RP029443 100 ug Ask for price

SMS Recombinant Protein (Mouse)

RP174068 100 ug Ask for price

TEK Rabbit pAb

A0743-100ul 100 ul
EUR 308

TEK Rabbit pAb

A0743-200ul 200 ul
EUR 459

TEK Rabbit pAb

A0743-20ul 20 ul
EUR 183

TEK Rabbit pAb

A0743-50ul 50 ul
EUR 223

TEK Conjugated Antibody

C37274 100ul
EUR 397

TEK Rabbit pAb

A7222-100ul 100 ul
EUR 308

TEK Rabbit pAb

A7222-200ul 200 ul
EUR 459

TEK Rabbit pAb

A7222-20ul 20 ul
EUR 183

TEK Rabbit pAb

A7222-50ul 50 ul
EUR 223

Anti-TEK antibody

STJ25807 100 µl
EUR 277
Description: This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Anti-TEK antibody

STJ29302 100 µl
EUR 277
Description: This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Anti-TEK Antibody

STJ503257 100 µg
EUR 476

Anti-TEK Antibody

STJ503258 100 µg
EUR 476

8-hydroxy Guanosine, compound

8OHG15-N-1 1 mg
EUR 202

8-hydroxy Guanosine, compound

8OHG15-N-5 5 mg
EUR 590

PKM2 inhibitor(compound 3k)

B8217-25 25 mg
EUR 412

PKM2 inhibitor(compound 3k)

B8217-5 5 mg
EUR 168

CCT251545 analogue, Compound 51

A8739-25 25 mg
EUR 1442
Description: CCT251545 analogue, Compound 51 is a potent and selective CDK8/19 inhibitor with IC50 values of 5.1 nM and 5.6 nM, respectively [1]. Mediator complex-associated kinases CDK8 and CDK19 are involved in the regulation of multiple transcription pathways.

CCT251545 analogue, Compound 51

A8739-5 5 mg
EUR 456
Description: CCT251545 analogue, Compound 51 is a potent and selective CDK8/19 inhibitor with IC50 values of 5.1 nM and 5.6 nM, respectively [1]. Mediator complex-associated kinases CDK8 and CDK19 are involved in the regulation of multiple transcription pathways.

Arrhythmias-Targeting Compound 1

HY-101750 20mg
EUR 5683

NPS ALX Compound 4a

HY-103090 5mg
EUR 291

Cancer-Targeting Compound 1

HY-U00300 1mg
EUR 849

Neuromuscular-targeting compound 1

HY-U00310 20mg
EUR 4803

Itch-Targeting Compound 1

HY-U00361 20mg
EUR 11180

Arrhythmic-Targeting Compound 1

HY-U00393 5mg
EUR 9361

Asthma relating compound 1

HY-U00412 5mg
EUR 2846

DiscoveryProbe? Bioactive Compound Library

L1022-.1 100 uL/well(10 mM solution)
EUR 23389

DiscoveryProbe? Bioactive Compound Library

L1022-.25 250 uL/well(10 mM solution)
EUR 42042

DiscoveryProbe? Bioactive Compound Library

L1022-5 5 mg/well
EUR 54686

DiscoveryProbe? GPCR Compound Library

L1025-.1 100 uL/well(10 mM solution)
EUR 4736

DiscoveryProbe? GPCR Compound Library

L1025-.25 250 uL/well(10 mM solution)
EUR 8518

DiscoveryProbe? GPCR Compound Library

L1025-5 5 mg/well
EUR 11070

DiscoveryProbe? Epigenetics Compound Library

L1029-.1 100 uL/well(10 mM solution)
EUR 5954

DiscoveryProbe? Epigenetics Compound Library

L1029-.25 250 uL/well(10 mM solution)
EUR 10722

DiscoveryProbe? Epigenetics Compound Library

L1029-5 5 mg/well
EUR 13970

DiscoveryProbe? Autophagy Compound Library

L1031-.1 100 uL/well(10 mM solution)
EUR 11174

DiscoveryProbe? Autophagy Compound Library

L1031-.25 250 uL/well(10 mM solution)
EUR 20118

DiscoveryProbe? Autophagy Compound Library

L1031-5 5 mg/well
EUR 26150

DiscoveryProbe? Apoptosis Compound Library

L1036-.1 100 uL/well(10 mM solution)
EUR 3472

DiscoveryProbe? Apoptosis Compound Library

L1036-.25 250 uL/well(10 mM solution)
EUR 6198

DiscoveryProbe? Apoptosis Compound Library

L1036-5 5 mg/well
EUR 8054

Polyclonal Sms antibody - middle region

APR01535G 0.05mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Sms - middle region. This antibody is tested and proven to work in the following applications:

Spermine Synthase (SMS) Antibody (HRP)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Spermine Synthase (SMS) Antibody (FITC)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Spermine Synthase (SMS) Antibody (Biotin)

  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Spermine Synthase (SMS) Protein

  • EUR 620.00
  • EUR 272.00
  • EUR 1859.00
  • EUR 732.00
  • EUR 453.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Sms ORF Vector (Rat) (pORF)

ORF076721 1.0 ug DNA
EUR 506

SMS ORF Vector (Human) (pORF)

ORF009815 1.0 ug DNA
EUR 95

Sms ORF Vector (Mouse) (pORF)

ORF058024 1.0 ug DNA
EUR 506

SMS ELISA Kit (Human) (OKEH08190)

OKEH08190 96 Wells
EUR 1092
Description: Description of target: This gene encodes a protein belonging to the spermidine/spermin synthase family and catalyzes the production of spermine from spermidine. Pseudogenes of this gene are located on chromosomes 1, 5, 6 and X. Mutations in this gene cause an X-linked intellectual disability called Snyder-Robinson Syndrome (SRS). Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.138ng/mL

Oct-1 Blocking Peptide

EUR 153

Oct-2 Blocking Peptide

EUR 153

Oct-4 Blocking Peptide

EUR 153

Polyclonal Oct-4 Antibody

APR00138G 0.1mg
EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Oct-4 . This antibody is tested and proven to work in the following applications:

Anti-Oct-1 Antibody

A01766 1ml
EUR 456
Description: Rabbit Polyclonal Oct-1 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Anti-Oct-1 Antibody

A01766-2 100ul
EUR 397
Description: Rabbit Polyclonal Oct-1 Antibody. Validated in IF, WB and tested in Human, Mouse.

Anti-Oct-2 Antibody

A04407 1ml
EUR 456
Description: Rabbit Polyclonal Oct-2 Antibody. Validated in IHC and tested in Human, Mouse, Rat.

Oct 3/4 antibody

70R-OR005 100 ug
EUR 300
Description: Affinity purified Rabbit polyclonal Oct 3/4 antibody


EHO0308 96Tests
EUR 521

Bovine OCT ELISA Kit

EBO0308 96Tests
EUR 521

Anserini OCT ELISA Kit

EAO0308 96Tests
EUR 521

Chicken OCT ELISA Kit

ECKO0308 96Tests
EUR 521

Canine OCT ELISA Kit

ECO0308 96Tests
EUR 521


EGTO0308 96Tests
EUR 521


EF007021 96 Tests
EUR 689

Oct-6 Conjugated Antibody

C44376 100ul
EUR 397

Oct-6 Blocking Peptide

AF9136-BP 1mg
EUR 195

Oct-1 Polyclonal Antibody

ABP52000-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from human 41183 around the non-phosphorylation site of S385
  • Applications tips:
Description: A polyclonal antibody for detection of Oct-1 from Human, Mouse, Rat. This Oct-1 antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from human 41183 around the non-phosphorylation site of S385