Neutralizing Anti Ody For Sars For Purchase

Lab Reagents

Human IgG antibody Laboratories manufactures the neutralizing anti ody for sars for purchase reagents distributed by Genprice. The Neutralizing Anti Ody For Sars For Purchase reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SARS Antibody. Other Neutralizing products are available in stock. Specificity: Neutralizing Category: Anti Group: Ody For

Ody For information

anti-SARS-M (2H2C4)

LF-MA30017 100 ul
EUR 354
Description: Mouse Monoclonal to SARS-M

Anti-SARS-E2 antibody

STJ98377 100 µl
EUR 234
Description: Mouse monoclonal to SARS-E2.

Anti-SARS-M antibody

STJ98378 100 µl
EUR 234
Description: Mouse monoclonal to SARS-M.

Horse Anti-Rabies Virus IgG (Fab2), neutralizing

RBV16-Fab2 100 ul
EUR 445

Cytomegalovirus gB Late Neutralizing Antigen (CMV-LA gB Neutralizing) Antibody

abx411283-02mg 0.2 mg
EUR 565
  • Shipped within 1 week.

D/E NEUTRALIZING AGAR

D04-112-10kg 10 kg
EUR 1536

D/E NEUTRALIZING AGAR

D04-112-2Kg 2 Kg
EUR 373

D/E NEUTRALIZING AGAR

D04-112-500g 500 g
EUR 138

D/E NEUTRALIZING BROTH

D04-115-10kg 10 kg
EUR 1009

D/E NEUTRALIZING BROTH

D04-115-2kg 2kg
EUR 258

D/E NEUTRALIZING BROTH

D04-115-500g 500 g
EUR 107

Interferon alpha Neutralizing Antibody

20-abx137013
  • EUR 356.00
  • EUR 523.00
  • 0.5 mg
  • 1 mg
  • Shipped within 5-10 working days.

Anti-SARS-CoV-2 Antibody

A2061-50 50 µg
EUR 480

Human Monoclonal anti-Influenza A hemeagglutinin (HA stem loop) IgG1 (neutralizing for H1N1, H5N1, H6N1, H9N2 etc)

H1N14-M 100 ul
EUR 482

Sars/ Rat Sars ELISA Kit

ELI-41050r 96 Tests
EUR 886

Cytomegalovirus gB Late Neutralizing Antigen (CMV-LA gB Neutralizing) Antibody (FITC)

abx411284-01mg 0.1 mg
EUR 509
  • Shipped within 1 week.

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280

Goat Anti-Human Respiratory Syncytial Virus (RSV) IgG, neutralizing

RSV12-S 100 ul
EUR 457

Mouse Monoclonal Anti-SARS Spike IgG

AB-17910 50 ug
EUR 469

SARS antibody

70R-20086 50 ul
EUR 435
Description: Rabbit polyclonal SARS antibody

SARS antibody

70R-1444 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the C terminal of SARS

SARS antibody

70R-1445 100 ug
EUR 377
Description: Rabbit polyclonal SARS antibody raised against the middle region of SARS

SARS antibody

39139-100ul 100ul
EUR 252

SARS Antibody

1-CSB-PA04145A0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:1000-1:5000, IHC:1:20-1:200

SARS Antibody

1-CSB-PA020709GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

SARS siRNA

20-abx904776
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932473
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SARS siRNA

20-abx932474
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pENTR223-SARS

PVT12269 2 ug
EUR 391

Human Monoclonal Anti-Chikungunya virus (CHIKV) E1_E2 protein IgG1 (neutralizing)

CHIKE13-M 100 ul
EUR 482

Rabbit Anti-Poliomyelitis Virus 1 (LSc,2ab strain) antiserum, neutralizing

POLV16-S 100 ul
EUR 457

anti-SARS spike glycoprotein antibody (clone 3A2)

65-101 50ug
EUR 296
Description: The anti-SARS spike glycoprotein antibody (clone 3A2) is available in Europe and for worldwide shipping via Gentaur.

Mouse Monoclonal Anti-SARS Spike Protein IgG

AB-15710 20 ug
EUR 408

Mouse Monoclonal Anti-SARS Nucleocapsid protein IgG

AB-17810 50 ug
EUR 469

Mouse Monoclonal Anti-SARS Nucleocapsid Protein IgG

AB-18010 50 ug
EUR 469

Anti-SARS-CoV-2 Antibody (Clone# 6F10)

A2060-50 50 µg
EUR 480

Anti-SARS-CoV NP Mouse IgG2b Antibody

A2064-100 100 µg
EUR 318

Anti-SARS-CoV NP Mouse IgG1 Antibody

A2066-100 100 µg
EUR 318

Anti-SARS-CoV-2 Spike S1 Antibody

A3000-50 50 µg
EUR 419

Monoclonal NGF/proNGF Neutralizing Antibody Antibody

AMM06679G 0.05mg
EUR 528
Description: A Monoclonal antibody against Human NGF/proNGF Neutralizing. The antibodies are raised in Mouse. This antibody is applicable in E

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP13416-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP13416-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP13416-500ug 500ug
EUR 663

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-100ug

QP13417-100ug 100ug
EUR 218

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-1mg

QP13417-1mg 1mg
EUR 1061

Recombinant SARS SARS Envelope Protein, Untagged, E.coli-500ug

QP13417-500ug 500ug
EUR 663

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-100ug

QP13418-100ug 100ug
EUR 218

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-1mg

QP13418-1mg 1mg
EUR 1061

Recombinant SARS SARS Matrix Protein, Untagged, E.coli-500ug

QP13418-500ug 500ug
EUR 663

Recombinant SARS SARS MERS Protein, His, E.coli-100ug

QP13419-100ug 100ug
EUR 218

Recombinant SARS SARS MERS Protein, His, E.coli-1mg

QP13419-1mg 1mg
EUR 1261

Recombinant SARS SARS MERS Protein, His, E.coli-500ug

QP13419-500ug 500ug
EUR 663

Recombinant SARS SARS-CoV Protein, His, E.coli-1mg

QP13423-1mg 1mg
EUR 3954

Recombinant SARS SARS-CoV Protein, His, E.coli-20ug

QP13423-20ug 20ug
EUR 201

Recombinant SARS SARS-CoV Protein, His, E.coli-5ug

QP13423-5ug 5ug
EUR 155

Recombinant SARS SARS Core Protein, Untagged, E.coli-100ug

QP10499-100ug 100ug
EUR 218

Recombinant SARS SARS Core Protein, Untagged, E.coli-1mg

QP10499-1mg 1mg
EUR 1061

Recombinant SARS SARS Core Protein, Untagged, E.coli-500ug

QP10499-500ug 500ug
EUR 663

SARS Spike Antibody

24216-100ul 100ul
EUR 390

SARS Spike Antibody

24217-100ul 100ul
EUR 390

SARS Spike Antibody

24218-100ul 100ul
EUR 390

SARS Spike Antibody

24219-100ul 100ul
EUR 390

SARS Spike Antibody

24318-100ul 100ul
EUR 390

SARS Matrix Antibody

24319-100ul 100ul
EUR 390

SARS Matrix Antibody

24320-100ul 100ul
EUR 390

SARS Envelope Antibody

24321-100ul 100ul
EUR 390

SARS Envelope Antibody

24322-100ul 100ul
EUR 390

SARS Rabbit pAb

A13350-100ul 100 ul
EUR 308

SARS Rabbit pAb

A13350-200ul 200 ul
EUR 459

SARS Rabbit pAb

A13350-20ul 20 ul
EUR 183

SARS Rabbit pAb

A13350-50ul 50 ul
EUR 223

SARS Blocking Peptide

33R-8713 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1445

SARS Blocking Peptide

33R-7048 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SARS antibody, catalog no. 70R-1444

SARS E2 antibody

10R-1976 100 ul
EUR 241
Description: Mouse monoclonal SARS E2 antibody

SARS M antibody

10R-1977 100 ul
EUR 241
Description: Mouse monoclonal SARS M antibody

SARS Coronavirus antibody

10C-CR9003M1 100 ug
EUR 499
Description: Mouse monoclonal SARS Coronavirus antibody

SARS Nucleocapsid antibody

10R-10470 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS Nucleocapsid antibody

10R-10471 100 ug
EUR 435
Description: Mouse monoclonal SARS Nucleocapsid antibody

SARS S1 [His]

DAG1861 500 ug
EUR 2529

SARS S2 [His]

DAG1862 500 ug
EUR 2529

SARS-E2 Antibody

abx016055-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS-M Antibody

abx016056-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137184
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1720.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137185
  • EUR 1052.00
  • EUR 1539.00
  • EUR 1970.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Spike Antibody

20-abx137200
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Nucleocapsid Antibody

20-abx137201
  • EUR 1177.00
  • EUR 1887.00
  • EUR 2221.00
  • 100 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

SARS Conjugated Antibody

C39139 100ul
EUR 397

SARS cloning plasmid

CSB-CL020709HU1-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS cloning plasmid

CSB-CL020709HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1545
  • Sequence: atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacc
  • Show more
Description: A cloning plasmid for the SARS gene.

SARS Rabbit pAb

A6733-100ul 100 ul
EUR 308

SARS Rabbit pAb

A6733-200ul 200 ul
EUR 459

SARS Rabbit pAb

A6733-20ul 20 ul
EUR 183

SARS Rabbit pAb

A6733-50ul 50 ul
EUR 223

SARS Polyclonal Antibody

A53977 100 µg
EUR 570.55
Description: The best epigenetics products

SARS Protease Substrate

H-5982.0500 0.5mg
EUR 297
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

SARS Protease Substrate

H-5982.1000 1.0mg
EUR 515
Description: Sum Formula: C66H119N21O22S; CAS# [587886-51-9] net

Mouse Monoclonal Anti-HIV-1 gp120 (PND, principal neutralizing domain) IgG

AB-15110 100 ug
EUR 347

Mouse monoclonal Anti-MERS Spike protein RBD (MES-RBD) IgG1 (neutralizing)

MERS125-M 100 ul
EUR 482

Rabbit Anti-Poliomyelitis Virus 2 (P712,Ch,2ab strain) antiserum, neutralizing

POLV22-S 100 ul
EUR 457

G. Pig anti-Poliomyelitis Virus 2 (sabin strain, native) antiserum, neutralizing

POLV23-S 100 ul
EUR 457

Rabbit Anti-Poliomyelitis Virus 3 (Leon1,Ch,2ab strain) antiserum, neutralizing

POLV32-S 100 ul
EUR 457

G. Pig anti-Poliomyelitis Virus 3 (sabin strain, native) antiserum, neutralizing

POLV33-S 100 ul
EUR 457

Mouse monoclona Anti-Rabies Virus Glycoprotein (RVG) IgG, neutralizing (clone 1)

RBVGP12-M 100 ul
EUR 482

Mouse monoclona Anti-Rabies Virus Glycoprotein (RVG) IgG, neutralizing (clone 2)

RBVGP13-M 100 ul
EUR 482

Anti-MERS & SARS-CoV NP Mouse IgG1 Antibody

A2063-100 100 µg
EUR 318

Anti-SARS-CoV-2 NP Antibody (Clone# 11D5)

A2092-50 50 µg
EUR 480

Anti-SARS-CoV-2 NP Antibody (Clone# 4G1)

A2093-50 50 µg
EUR 480

for Anti-IFNg Antibody (Anti-F2) ELISA Kit

AEA049Hu-10x96wellstestplate 10x96-wells test plate
EUR 6040.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-IFNg Antibody (Anti-F2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Indirect ELISA Enzyme-linked immunosorbent assay for detection of for Anti-IFNg Antibody (Anti-F2) in serum.

for Anti-IFNg Antibody (Anti-F2) ELISA Kit

AEA049Hu-1x48wellstestplate 1x48-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-IFNg Antibody (Anti-F2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Indirect ELISA Enzyme-linked immunosorbent assay for detection of for Anti-IFNg Antibody (Anti-F2) in serum.

for Anti-IFNg Antibody (Anti-F2) ELISA Kit

AEA049Hu-1x96wellstestplate 1x96-wells test plate
EUR 793
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-IFNg Antibody (Anti-F2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Indirect ELISA Enzyme-linked immunosorbent assay for detection of for Anti-IFNg Antibody (Anti-F2) in serum.

for Anti-IFNg Antibody (Anti-F2) ELISA Kit

AEA049Hu-5x96wellstestplate 5x96-wells test plate
EUR 3268.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-IFNg Antibody (Anti-F2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Indirect ELISA Enzyme-linked immunosorbent assay for detection of for Anti-IFNg Antibody (Anti-F2) in serum.

ELISA Kit for Anti-IFNg Antibody (Anti-F2)

4-AEA049Hu
  • EUR 6091.00
  • EUR 3219.00
  • EUR 794.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-IFNg Antibody elisa. Alternative names of the recognized antigen: IFN-G
  • IFG
  • IFI
  • INFr
  • IFN, Immune Interferon
Description: Enzyme-linked immunosorbent assay based on the Indirect ELISA method for detection of Anti-IFNg Antibody (Anti-F2) in samples from Serum with no significant corss-reactivity with analogues from other species.

Rabbit monoclonal Anti-MERS Spike protein (S1/RBD/MERS-RBD) IgG (Neutralizing)

MERS122-M 100 ul
EUR 651

Horse Anti-C. tetani purified toxin/Toxoid IgG (Fab2), Tetanus antitoxin (neutralizing)

TTOX20-Fab2 100 ul
EUR 445

Humanized Monoclonal Anti-Human VEGF protein (Avastin/bevacizumab biosimilar) protein IgG1 (neutralizing)

VEGF19-M 50 ug
EUR 482

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-100ug

QP13420-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-1mg

QP13420-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(C) Protein, Untagged, E.coli-500ug

QP13420-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-100ug

QP13421-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-1mg

QP13421-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(M) Protein, Untagged, E.coli-500ug

QP13421-500ug 500ug
EUR 663

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-100ug

QP13422-100ug 100ug
EUR 218

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-1mg

QP13422-1mg 1mg
EUR 1061

Recombinant SARS SARS Mosaic S(N) Protein, Untagged, E.coli-500ug

QP13422-500ug 500ug
EUR 663

Polyclonal SARS Matrix Antibody

APG02976G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

SARS Antibody, HRP conjugated

1-CSB-PA04145B0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SARS Antibody, FITC conjugated

1-CSB-PA04145C0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SARS Antibody, Biotin conjugated

1-CSB-PA04145D0Rb
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SARS. Recognizes SARS from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SARS protein (His tag)

80R-2099 50 ug
EUR 322
Description: Recombinant human SARS protein (His tag)

SARS N Protein Antibody

abx018255-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS N Protein Antibody

abx018256-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sn Antibody

abx032683-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

SARS virus Sm Antibody

abx032684-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

ACE2 (SARS Receptor) Antibody

abx032686-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

SARS CoV E Protein

abx060650-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS CoV Nucleocapsid Protein

abx060652-1mg 1 mg
EUR 1873
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060653-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Nucleocapsid Protein

abx060654-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS-CoV Spike Protein

abx060655-1mg 1 mg
EUR 1692
  • Shipped within 5-10 working days.

SARS ELISA KIT|Human

EF002719 96 Tests
EUR 689

Rat SARS shRNA Plasmid

20-abx988123
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse SARS shRNA Plasmid

20-abx972567
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal SARS Matrix Antibody

APR11178G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human SARS Matrix . This antibody is tested and proven to work in the following applications:

Human SARS shRNA Plasmid

20-abx954245
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

SARS Recombinant Protein (Human)

RP027604 100 ug Ask for price

SARS Recombinant Protein (Human)

RP027607 100 ug Ask for price

SARS Recombinant Protein (Rat)

RP227480 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170009 100 ug Ask for price

SARS Recombinant Protein (Mouse)

RP170012 100 ug Ask for price

Recombinant SARS Matrix Protein

VAng-Lsx0059-inquire inquire Ask for price
Description: SARS Matrix, recombinant protein from E. coli.

Human monoclonal anti-Influenza A hemeagglutinin (HA) IgG (IgG1, recombinant HEK cells, >95%) (Pan antibody, neutralizing for H1, H2, H5, H6, H8, H9 etc)

H1N13-M 100 ul
EUR 482

Anti-CoV-2 & SARS-CoV S1 Antibody (Clone# CR3022)

A2103-200 200 µg
EUR 480

Anti-SARS-CoV-2 Spike S1 Antibody (Clone# 4C6)

A3001-50 50 µg
EUR 419

For Anti-Interleukin 12 Antibody (Anti-IL12)ELISA kit

AEA111Hu-10x96wellstestplate 10x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of For Anti-Interleukin 12 Antibody (Anti-IL12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of For Anti-Interleukin 12 Antibody (Anti-IL12) in serum, plasma and other biological fluids.

For Anti-Interleukin 12 Antibody (Anti-IL12)ELISA kit

AEA111Hu-1x48wellstestplate 1x48-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of For Anti-Interleukin 12 Antibody (Anti-IL12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of For Anti-Interleukin 12 Antibody (Anti-IL12) in serum, plasma and other biological fluids.

For Anti-Interleukin 12 Antibody (Anti-IL12)ELISA kit

AEA111Hu-1x96wellstestplate 1x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of For Anti-Interleukin 12 Antibody (Anti-IL12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of For Anti-Interleukin 12 Antibody (Anti-IL12) in serum, plasma and other biological fluids.

For Anti-Interleukin 12 Antibody (Anti-IL12)ELISA kit

AEA111Hu-5x96wellstestplate 5x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of For Anti-Interleukin 12 Antibody (Anti-IL12) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assa
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of For Anti-Interleukin 12 Antibody (Anti-IL12) in serum, plasma and other biological fluids.

ELISA Kit For Anti-Interleukin 12 Antibody (Anti-IL12)

4-AEA111Hu
  • Ask for price
  • Ask for price
  • Ask for price
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Interleukin 12 Antibody elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Anti-Interleukin 12 Antibody (Anti-IL12) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB)ELISA kit

AEA311Hu-10x96wellstestplate 10x96-wells test plate
EUR 6040.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) in serum, plasma and other biological fluids.

for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB)ELISA kit

AEA311Hu-1x48wellstestplate 1x48-wells test plate
EUR 585.1
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) in serum, plasma and other biological fluids.

for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB)ELISA kit

AEA311Hu-1x96wellstestplate 1x96-wells test plate
EUR 793
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) in serum, plasma and other biological fluids.

for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB)ELISA kit

AEA311Hu-5x96wellstestplate 5x96-wells test plate
EUR 3268.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Int
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) in serum, plasma and other biological fluids.

ELISA Kit for Anti-Deoxyribonuclease B Antibody (Anti-DNaseB)

4-AEA311Hu
  • EUR 6091.00
  • EUR 3219.00
  • EUR 794.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Anti-Deoxyribonuclease B Antibody elisa. Alternative names of the recognized antigen: Anti-DNase B
  • Antideoxyribonuclease B
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Anti-Deoxyribonuclease B Antibody (Anti-DNaseB) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Human Anti-ALB (Anti-Albumin Antibody)

ELK7831 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Albumin Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Anti-Apo (Anti-Apolipoprotein Antibody)

ELK7859 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Apolipoprotein Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Anti-MPO (Anti-Myeloperoxidase Antibody)

ELK8009 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Myeloperoxidase Antibody from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Pig Anti-SST (Anti-Somatostatin Antibody)

ELK8180 1 plate of 96 wells
EUR 526
  • The microtiter plate provided in this kit has been pre-coated with an antigen. Standards or samples are then added to the appropriate microtiter plate wells with a Horseradish Peroxidase (HRP)-conjugated secondary antibody. After TMB substrate soluti
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Anti-Somatostatin Antibody from Pig in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Classical Porcine Fever Virus Neutralizing Antibody ELISA Kit

RK04111 96T
EUR 521

ELISA kit for Human AT (Anti Thrombin)

E-EL-H0432 1 plate of 96 wells
EUR 534
  • Gentaur's AT ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human AT. Standards or samples are added to the micro ELISA plate wells and combined with the sp
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human AT (Anti Thrombin) in samples from Serum, Plasma, Cell supernatant

Anti-S-100 (For ICC use only)

DB-232-0.05 50 μl
EUR 300

Anti-S-100 (For ICC use only)

DB-232-0.1 100 μl
EUR 473

Anti-Cytokeratin 18 (For ICC use only)

DB-233-0.05 50 μl
EUR 300

Anti-Cytokeratin 18 (For ICC use only)

DB-233-0.1 100 μl
EUR 473

Anti-Cytokeratin 19 (For ICC use only)

DB-234-0.05 50 μl
EUR 300

Anti-Cytokeratin 19 (For ICC use only)

DB-234-0.1 100 μl
EUR 473

Anti-CD3/CD28 stimulus for human PBMC

CT372 50 tests
EUR 118

ELISA kit for Porcine AT (Anti Thrombin)

E-EL-P1079 1 plate of 96 wells
EUR 584
  • Gentaur's AT ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Porcine AT. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Porcine AT (Anti Thrombin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human Anti-Survivin antibody

EK3989 96 tests
EUR 586
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Anti-Survivin antibody in samples from serum, plasma, tissue homogenates and other biological fluids.

for Anti-Mullerian Hormone (AMH)ELISA kit

CCA228Ra-10x96wellstestplate 10x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Mullerian Hormone (AMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Anti-Mullerian Hormone (AMH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

for Anti-Mullerian Hormone (AMH)ELISA kit

CCA228Ra-1x48wellstestplate 1x48-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Mullerian Hormone (AMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Anti-Mullerian Hormone (AMH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

for Anti-Mullerian Hormone (AMH)ELISA kit

CCA228Ra-1x96wellstestplate 1x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Mullerian Hormone (AMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Anti-Mullerian Hormone (AMH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

for Anti-Mullerian Hormone (AMH)ELISA kit

CCA228Ra-5x96wellstestplate 5x96-wells test plate Ask for price
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Anti-Mullerian Hormone (AMH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of for Anti-Mullerian Hormone (AMH) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Positive Control for Anti-Rat CYP3A2 Antibody

P3A2PTCON 100 uL
EUR 125

Positive Control for Anti-Human CYP3A Antibody

P3ACON 100 uL
EUR 125