Tissue Tek Oct Compound Polyvinyl Alcohol Electron Microscopy Sciences Sds

Lab Reagents

Human IgG antibody Laboratories manufactures the tissue tek oct compound polyvinyl alcohol electron microscopy sciences sds reagents distributed by Genprice. The Tissue Tek Oct Compound Polyvinyl Alcohol Electron Microscopy Sciences Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact tissue tek compound. Other Tissue products are available in stock. Specificity: Tissue Category: Tek Group: Oct Compound

Oct Compound information

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit
DLR-OCT-b-48T	DL Develop	48T	EUR 569
Should the Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit
DLR-OCT-b-96T	DL Develop	96T	EUR 746
Should the Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit
DLR-OCT-Hu-48T	DL Develop	48T	EUR 498
Should the Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit
DLR-OCT-Hu-96T	DL Develop	96T	EUR 647
Should the Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit
DLR-OCT-Ra-48T	DL Develop	48T	EUR 528
Should the Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit
DLR-OCT-Ra-96T	DL Develop	96T	EUR 690
Should the Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RDR-OCT-b-48Tests	Reddot Biotech	48 Tests	EUR 607

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RDR-OCT-b-96Tests	Reddot Biotech	96 Tests	EUR 845

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RDR-OCT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 522

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RDR-OCT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 724

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RDR-OCT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 558

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RDR-OCT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 776

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RD-OCT-b-48Tests	Reddot Biotech	48 Tests	EUR 580

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RD-OCT-b-96Tests	Reddot Biotech	96 Tests	EUR 807

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RD-OCT-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RD-OCT-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RD-OCT-Ra-48Tests	Reddot Biotech	48 Tests	EUR 534

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit
RD-OCT-Ra-96Tests	Reddot Biotech	96 Tests	EUR 742

Fluorescence Microscopy Aid
4400	Virostat	3 ml	EUR 180.5
Description: This is Counter - Stain/Blocking Diluent with optimal formula for preparaiton of final dilutions of FITC conjugate prior to use in FA procedures.

Benzyl alcohol
GK3443-1KG	Glentham Life Sciences	1 kg	EUR 56

Benzyl alcohol
GK3443-250G	Glentham Life Sciences	250 g	EUR 43

Benzyl alcohol
GK3443-500G	Glentham Life Sciences	500 g	EUR 48

Benzyl alcohol
GK3443-5KG	Glentham Life Sciences	5 kg	EUR 118

(-)-Perillyl alcohol
GK5476-25G	Glentham Life Sciences	25 g	EUR 106

(-)-Perillyl alcohol
GK5476-50G	Glentham Life Sciences	50 g	EUR 166

(-)-Perillyl alcohol
GK5476-5G	Glentham Life Sciences	5 g	EUR 54

SDS
SB0485	Bio Basic	100g	EUR 67.4
Product category: Biochemicals/Detergents/Surfactants

2-Hydroxybenzyl alcohol
GK9908-100G	Glentham Life Sciences	100 g	EUR 94

2-Hydroxybenzyl alcohol
GK9908-250G	Glentham Life Sciences	250 g	EUR 174

2-Hydroxybenzyl alcohol
GK9908-25G	Glentham Life Sciences	25 g	EUR 52

2-Hydroxybenzyl alcohol
GK9908-50G	Glentham Life Sciences	50 g	EUR 66

Sds/ Rat Sds ELISA Kit
ELI-15462r	Lifescience Market	96 Tests	EUR 886

Compound W
2208-250	Biovision		EUR 300

Compound W
2208-50	Biovision		EUR 115

Compound 112254
2573-25	Biovision		EUR 588

Compound 112254
2573-5	Biovision		EUR 185

Compound 401
1657-5	Biovision		EUR 238

Compound 1
1688-5	Biovision		EUR 207

Compound 34
1898-1000	Biovision		EUR 457

Compound 34
1898-200	Biovision		EUR 158

Compound E
1949-1000	Biovision		EUR 370

Compound E
1949-250	Biovision		EUR 153

Compound CL0485
ADC-P-074	Creative Biolabs	unit	Ask for price

Compound 401
B7337-10	ApexBio	10 mg	EUR 224

Compound 401
B7337-25	ApexBio	25 mg	EUR 441

Compound 401
B7337-5	ApexBio	5 mg	EUR 180

Compound W
A4401-50	ApexBio	50 mg	EUR 177
Description: Inhibitor of ?-secretase; causes a decrease in the released levels of A?42 and notch-1 A?-like peptide 25 (N?25).

Compound 56
A8197-.5	ApexBio	500 µg	EUR 108
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56
A8197-5	ApexBio	5 mg	EUR 224
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56
A8197-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 270
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56
A8197-S	ApexBio	Evaluation Sample	EUR 81
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound E
HY-14176	MedChemExpress	10mM/1mL	EUR 694

Compound 401
HY-19341	MedChemExpress	10mM/1mL	EUR 186

Compound 2
HY-U00358	MedChemExpress	10mg	EUR 6041

Compound K
N1890-20	ApexBio	20 mg	EUR 340
Description: Compound K

Imidazoquinoline Compound
VAdv-Ly0028	Creative Biolabs	5 mg	EUR 3280
Description: Imidazoquinoline compound, a TLR7 agonist vaccine adjuvant.

SDS Solution
2102-100	Biovision		EUR 137

SDS antibody
10R-5712	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
10R-5718	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
10R-5720	Fitzgerald	100 ul	EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody
70R-3627	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody
70R-3762	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS siRNA
20-abx904833	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SDS siRNA
20-abx932743	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SDS siRNA
20-abx932744	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

10% SDS
TG4060	TopoGen	1ml	EUR 134

anti-SDS
YF-PA17352	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to SDS

TEK antibody
70R-20759	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal TEK antibody

TEK Antibody
37274-100ul	SAB	100ul	EUR 252

TEK Antibody
1-CSB-PA050236	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

TEK Antibody
1-CSB-PA050237	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TEK Antibody
1-CSB-PA982820	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEK Antibody
1-CSB-PA041300	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TEK Antibody
1-CSB-PA023375GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TEK siRNA
20-abx936459	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-TEK
YF-PA27377	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to TEK

Dorsomorphin (Compound C)
B3252-10	ApexBio	10 mg	EUR 137
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Dorsomorphin (Compound C)
B3252-5	ApexBio	5 mg	EUR 108
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Dorsomorphin (Compound C)
B3252-50	ApexBio	50 mg	EUR 340
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Teijin compound 1
B5468-10	ApexBio	10 mg	EUR 389

Teijin compound 1
B5468-50	ApexBio	50 mg	EUR 1476

GPR120 Compound A
C5824-10	ApexBio	10 mg	EUR 293
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

GPR120 Compound A
C5824-5	ApexBio	5 mg	EUR 197
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

GPR120 Compound A
C5824-50	ApexBio	50 mg	EUR 920
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

Antibacterial compound 2
HY-101730	MedChemExpress	5mg	EUR 7984

Antibacterial compound 1
HY-101819	MedChemExpress	5mg	EUR 2198

Teijin compound 1
HY-108323	MedChemExpress	5mg	EUR 312

Antiasthmatic Compound 1
HY-U00409	MedChemExpress	1mg	EUR 849

APHA Compound 8
M45003	EpiGentek	1 mg	EUR 284.9
Description: Ask the seller for details

dAbs scaffold protein anti-Human B5R
SDS-L073	Creative Biolabs	1 mg	EUR 4496
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution
A0030	Bio Basic	4L	EUR 94.8
Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder
TD8135	Bio Basic	1PK, 10L	EUR 76.1
Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4
UA0030	Bio Basic	500ml	EUR 67.4
Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody
27842-100ul	SAB	100ul	EUR 252

SDS Polyclonal Antibody
27842-50ul	SAB	50ul	EUR 187

SDS Rabbit pAb
A12898-100ul	Abclonal	100 ul	EUR 308

SDS Rabbit pAb
A12898-200ul	Abclonal	200 ul	EUR 459

SDS Rabbit pAb
A12898-20ul	Abclonal	20 ul	EUR 183

SDS Rabbit pAb
A12898-50ul	Abclonal	50 ul	EUR 223

SDS Blocking Peptide
33R-4446	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide
33R-1011	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid
CSB-CL020926HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover
P5W12	101Bio	NULL	EUR 0

100G SDS Ultrapure
NAT1072	National Diagnostics	100G	EUR 93

1KG SDS Ultrapure
NAT1074	National Diagnostics	1KG	EUR 306

10% SDS Solution
S0792-050	GenDepot	500ml	EUR 93

10% SDS Solution
S0792-100	GenDepot	2X500ml	EUR 122

20% SDS Solution
S0793-050	GenDepot	500ml	EUR 120

20% SDS Solution
S0793-100	GenDepot	2X500ml	EUR 166

SurfactAway™ SDS
SA645-30	Biotech Support Group	30 mL	EUR 379

SurfactAway™ SDS
SA646-250	Biotech Support Group	250 mL	EUR 1389

Anti-SDS antibody
STJ114764	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Anti-SDS (1A9)
YF-MA17551	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to SDS

Oct 1 antibody
20R-1517	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal Oct 1 antibody

Oct 2 antibody
20R-1652	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal Oct 2 antibody

Oct 4 antibody
20R-1653	Fitzgerald	100 ug	EUR 673
Description: Rabbit polyclonal Oct 4 antibody

OCT-4 Antibody
21424-100ul	SAB	100ul	EUR 252

OCT-4 Antibody
21424-50ul	SAB	50ul	EUR 187

Oct-1 Antibody
21674-100ul	SAB	100ul	EUR 252

Oct-1 Antibody
21674-50ul	SAB	50ul	EUR 187

Oct-1 Antibody
3342-100	Biovision		EUR 316

Oct-1 Antibody
3342-30T	Biovision		EUR 146

Oct-2 Antibody
3575-100	Biovision		EUR 338

Oct-2 Antibody
3575-30T	Biovision		EUR 146

Oct-4 Antibody
3576-100	Biovision		EUR 441

Oct-4 Antibody
3576-30T	Biovision		EUR 146

Oct-1 Antibody
49901-100ul	SAB	100ul	EUR 333

Oct-1 Antibody
49901-50ul	SAB	50ul	EUR 239

Oct-6 Antibody
44376-100ul	SAB	100ul	EUR 252

Oct-6 Antibody
44376-50ul	SAB	50ul	EUR 187

Oct-6 Antibody
AF9136	Affbiotech	200ul	EUR 304
Description: Oct-6 Antibody detects endogenous levels of total Oct-6.

Oct- 6 Antibody
ABF9136	Lifescience Market	100 ug	EUR 438

OCT-4/POU5F1
MO47035	Neuromics	100 ul	EUR 349

TEK Rabbit pAb
A0743-100ul	Abclonal	100 ul	EUR 308

TEK Rabbit pAb
A0743-200ul	Abclonal	200 ul	EUR 459

TEK Rabbit pAb
A0743-20ul	Abclonal	20 ul	EUR 183

TEK Rabbit pAb
A0743-50ul	Abclonal	50 ul	EUR 223

TEK Conjugated Antibody
C37274	SAB	100ul	EUR 397

TEK Rabbit pAb
A7222-100ul	Abclonal	100 ul	EUR 308

TEK Rabbit pAb
A7222-200ul	Abclonal	200 ul	EUR 459

TEK Rabbit pAb
A7222-20ul	Abclonal	20 ul	EUR 183

TEK Rabbit pAb
A7222-50ul	Abclonal	50 ul	EUR 223

Anti-TEK antibody
STJ25807	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Anti-TEK antibody
STJ29302	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Anti-TEK Antibody
STJ503257	St John's Laboratory	100 µg	EUR 476

Anti-TEK Antibody
STJ503258	St John's Laboratory	100 µg	EUR 476

8-hydroxy Guanosine, compound
8OHG15-N-1	Alpha Diagnostics	1 mg	EUR 202

8-hydroxy Guanosine, compound
8OHG15-N-5	Alpha Diagnostics	5 mg	EUR 590

PKM2 inhibitor(compound 3k)
B8217-25	ApexBio	25 mg	EUR 412

PKM2 inhibitor(compound 3k)
B8217-5	ApexBio	5 mg	EUR 168

CCT251545 analogue, Compound 51
A8739-25	ApexBio	25 mg	EUR 1442
Description: CCT251545 analogue, Compound 51 is a potent and selective CDK8/19 inhibitor with IC50 values of 5.1 nM and 5.6 nM, respectively [1]. Mediator complex-associated kinases CDK8 and CDK19 are involved in the regulation of multiple transcription pathways.

CCT251545 analogue, Compound 51
A8739-5	ApexBio	5 mg	EUR 456
Description: CCT251545 analogue, Compound 51 is a potent and selective CDK8/19 inhibitor with IC50 values of 5.1 nM and 5.6 nM, respectively [1]. Mediator complex-associated kinases CDK8 and CDK19 are involved in the regulation of multiple transcription pathways.

Arrhythmias-Targeting Compound 1
HY-101750	MedChemExpress	20mg	EUR 5683

NPS ALX Compound 4a
HY-103090	MedChemExpress	5mg	EUR 291

Cancer-Targeting Compound 1
HY-U00300	MedChemExpress	1mg	EUR 849

Neuromuscular-targeting compound 1
HY-U00310	MedChemExpress	20mg	EUR 4803

Itch-Targeting Compound 1
HY-U00361	MedChemExpress	20mg	EUR 11180

Arrhythmic-Targeting Compound 1
HY-U00393	MedChemExpress	5mg	EUR 9361

Asthma relating compound 1
HY-U00412	MedChemExpress	5mg	EUR 2846

DiscoveryProbe? Bioactive Compound Library
L1022-.1	ApexBio	100 uL/well(10 mM solution)	EUR 23389

DiscoveryProbe? Bioactive Compound Library
L1022-.25	ApexBio	250 uL/well(10 mM solution)	EUR 42042

DiscoveryProbe? Bioactive Compound Library
L1022-5	ApexBio	5 mg/well	EUR 54686

DiscoveryProbe? GPCR Compound Library
L1025-.1	ApexBio	100 uL/well(10 mM solution)	EUR 4736

DiscoveryProbe? GPCR Compound Library
L1025-.25	ApexBio	250 uL/well(10 mM solution)	EUR 8518

DiscoveryProbe? GPCR Compound Library
L1025-5	ApexBio	5 mg/well	EUR 11070

DiscoveryProbe? Epigenetics Compound Library
L1029-.1	ApexBio	100 uL/well(10 mM solution)	EUR 5954

DiscoveryProbe? Epigenetics Compound Library
L1029-.25	ApexBio	250 uL/well(10 mM solution)	EUR 10722

DiscoveryProbe? Epigenetics Compound Library
L1029-5	ApexBio	5 mg/well	EUR 13970

DiscoveryProbe? Autophagy Compound Library
L1031-.1	ApexBio	100 uL/well(10 mM solution)	EUR 11174

DiscoveryProbe? Autophagy Compound Library
L1031-.25	ApexBio	250 uL/well(10 mM solution)	EUR 20118

DiscoveryProbe? Autophagy Compound Library
L1031-5	ApexBio	5 mg/well	EUR 26150

DiscoveryProbe? Apoptosis Compound Library
L1036-.1	ApexBio	100 uL/well(10 mM solution)	EUR 3472

DiscoveryProbe? Apoptosis Compound Library
L1036-.25	ApexBio	250 uL/well(10 mM solution)	EUR 6198

DiscoveryProbe? Apoptosis Compound Library
L1036-5	ApexBio	5 mg/well	EUR 8054

Isoamyl alcohol (Isopentyl Alcohol, 3-Methylbutanol)
ID0278	Bio Basic	500ml	EUR 73.93
Product category: Biochemicals/Solvents

Benzyl alcohol
20-abx184650	Abbexa	EUR 203.00 EUR 370.00 EUR 189.00 EUR 286.00 EUR 175.00	100 g 1 kg 25 g 500 g 5 g
Shipped within 1-2 weeks.

Hexyl alcohol
abx186467-500ml	Abbexa	500 ml	EUR 244
Shipped within 1-2 weeks.

Methallyl alcohol
abx186496-5g	Abbexa	5 g	EUR 203
Shipped within 1-2 weeks.

Benzyl alcohol
HY-B0892	MedChemExpress	10mM/1mL	EUR 126

Tribromoethyl alcohol
HY-B1372	MedChemExpress	1g	EUR 119

Salicyl alcohol
HY-B1419	MedChemExpress	100mg	EUR 119

Patchouli alcohol
HY-N0207	MedChemExpress	20mg	EUR 211

Vanillyl alcohol
HY-N2067	MedChemExpress	100mg	EUR 108

Coniferyl alcohol
HY-N4283	MedChemExpress	5mg	EUR 108

Veratryl alcohol
HY-107858	MedChemExpress	100mg	EUR 108

Cinnamyl Alcohol
HY-Y0078	MedChemExpress	5mg	EUR 108

Cinnamyl alcohol
N1483-20	ApexBio	20 mg	EUR 108
Description: Extracted from Cinnamomum cassia;Suitability:Ethanol,propylene glycol;Store the product in sealed,cool and dry condition

Patchouli alcohol
N1539-20	ApexBio	20 mg	EUR 189
Description: Extracted from Patchouli plants;Suitability:Ethanol and ethyl ether;Store the product in sealed,cool and dry condition

Patchouli alcohol
N1539-5.1	ApexBio	10 mM (in 1mL DMSO)	EUR 108
Description: Extracted from Patchouli plants;Suitability:Ethanol and ethyl ether;Store the product in sealed,cool and dry condition