Tissue Tek Oct Compound Polyvinyl Alcohol Electron Microscopy Sciences Sds

Lab Reagents

Human IgG antibody Laboratories manufactures the tissue tek oct compound polyvinyl alcohol electron microscopy sciences sds reagents distributed by Genprice. The Tissue Tek Oct Compound Polyvinyl Alcohol Electron Microscopy Sciences Sds reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact tissue tek compound. Other Tissue products are available in stock. Specificity: Tissue Category: Tek Group: Oct Compound

Oct Compound information

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

DLR-OCT-b-48T 48T
EUR 569
  • Should the Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

DLR-OCT-b-96T 96T
EUR 746
  • Should the Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Bovine Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

DLR-OCT-Hu-48T 48T
EUR 498
  • Should the Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

DLR-OCT-Hu-96T 96T
EUR 647
  • Should the Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

DLR-OCT-Ra-48T 48T
EUR 528
  • Should the Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

DLR-OCT-Ra-96T 96T
EUR 690
  • Should the Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Ornithine Carbamoyl Transferase (OCT) in samples from serum, plasma, tissue homogenates or other biological fluids.

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-b-48Tests 48 Tests
EUR 607

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-b-96Tests 96 Tests
EUR 845

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Hu-48Tests 48 Tests
EUR 522

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Hu-96Tests 96 Tests
EUR 724

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Ra-48Tests 48 Tests
EUR 558

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RDR-OCT-Ra-96Tests 96 Tests
EUR 776

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-b-48Tests 48 Tests
EUR 580

Bovine Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-b-96Tests 96 Tests
EUR 807

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Hu-48Tests 48 Tests
EUR 500

Human Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Hu-96Tests 96 Tests
EUR 692

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Ra-48Tests 48 Tests
EUR 534

Rat Ornithine Carbamoyl Transferase (OCT) ELISA Kit

RD-OCT-Ra-96Tests 96 Tests
EUR 742

Fluorescence Microscopy Aid

4400 3 ml
EUR 180.5
Description: This is Counter - Stain/Blocking Diluent with optimal formula for preparaiton of final dilutions of FITC conjugate prior to use in FA procedures.

Benzyl alcohol

GK3443-1KG 1 kg
EUR 56

Benzyl alcohol

GK3443-250G 250 g
EUR 43

Benzyl alcohol

GK3443-500G 500 g
EUR 48

Benzyl alcohol

GK3443-5KG 5 kg
EUR 118

(-)-Perillyl alcohol

GK5476-25G 25 g
EUR 106

(-)-Perillyl alcohol

GK5476-50G 50 g
EUR 166

(-)-Perillyl alcohol

GK5476-5G 5 g
EUR 54

SDS

SB0485 100g
EUR 67.4
  • Product category: Biochemicals/Detergents/Surfactants

2-Hydroxybenzyl alcohol

GK9908-100G 100 g
EUR 94

2-Hydroxybenzyl alcohol

GK9908-250G 250 g
EUR 174

2-Hydroxybenzyl alcohol

GK9908-25G 25 g
EUR 52

2-Hydroxybenzyl alcohol

GK9908-50G 50 g
EUR 66

Sds/ Rat Sds ELISA Kit

ELI-15462r 96 Tests
EUR 886

Compound W

2208-250
EUR 300

Compound W

2208-50
EUR 115

Compound 112254

2573-25
EUR 588

Compound 112254

2573-5
EUR 185

Compound 401

1657-5
EUR 238

Compound 1

1688-5
EUR 207

Compound 34

1898-1000
EUR 457

Compound 34

1898-200
EUR 158

Compound E

1949-1000
EUR 370

Compound E

1949-250
EUR 153

Compound CL0485

ADC-P-074 unit Ask for price

Compound 401

B7337-10 10 mg
EUR 224

Compound 401

B7337-25 25 mg
EUR 441

Compound 401

B7337-5 5 mg
EUR 180

Compound W

A4401-50 50 mg
EUR 177
Description: Inhibitor of ?-secretase; causes a decrease in the released levels of A?42 and notch-1 A?-like peptide 25 (N?25).

Compound 56

A8197-.5 500 µg
EUR 108
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56

A8197-5 5 mg
EUR 224
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56

A8197-5.1 10 mM (in 1mL DMSO)
EUR 270
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound 56

A8197-S Evaluation Sample
EUR 81
Description: Compound 56, 4-[(3-Bromophenyl)amino]-6,7-diethoxyquinazoline, is a potent and specific inhibitor of the tyrosine kinase of the epidermal growth factor receptor (EGFR) showing an IC50 of 0.006 nM.

Compound E

HY-14176 10mM/1mL
EUR 694

Compound 401

HY-19341 10mM/1mL
EUR 186

Compound 2

HY-U00358 10mg
EUR 6041

Compound K

N1890-20 20 mg
EUR 340
Description: Compound K

Imidazoquinoline Compound

VAdv-Ly0028 5 mg
EUR 3280
Description: Imidazoquinoline compound, a TLR7 agonist vaccine adjuvant.

SDS Solution

2102-100
EUR 137

SDS antibody

10R-5712 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5718 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

10R-5720 100 ul
EUR 691
Description: Mouse monoclonal SDS antibody

SDS antibody

70R-3627 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the N terminal of SDS

SDS antibody

70R-3762 50 ug
EUR 467
Description: Rabbit polyclonal SDS antibody raised against the middle region of SDS

SDS siRNA

20-abx904833
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS siRNA

20-abx932743
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

SDS siRNA

20-abx932744
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

10% SDS

TG4060 1ml
EUR 134

anti-SDS

YF-PA17352 50 ug
EUR 363
Description: Mouse polyclonal to SDS

TEK antibody

70R-20759 50 ul
EUR 435
Description: Rabbit polyclonal TEK antibody

TEK Antibody

37274-100ul 100ul
EUR 252

TEK Antibody

1-CSB-PA050236
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/5000

TEK Antibody

1-CSB-PA050237
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

TEK Antibody

1-CSB-PA982820
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:3000-1:10000, IHC:1:50-1:200

TEK Antibody

1-CSB-PA041300
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

TEK Antibody

1-CSB-PA023375GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against TEK. Recognizes TEK from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

TEK siRNA

20-abx936459
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TEK

YF-PA27377 50 ug
EUR 363
Description: Mouse polyclonal to TEK

Dorsomorphin (Compound C)

B3252-10 10 mg
EUR 137
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Dorsomorphin (Compound C)

B3252-5 5 mg
EUR 108
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Dorsomorphin (Compound C)

B3252-50 50 mg
EUR 340
Description: Dorsomorphin is a cell-permeable and reversible ATP-competitive inhibitor of AMP-activated protein kinase (AMPK) with Ki value of 109nM [1].Dorsomorphin is highly selective against AMPK over other structure related kinases such as protein kinase A, protein kinase C and Janus kinase 3.

Teijin compound 1

B5468-10 10 mg
EUR 389

Teijin compound 1

B5468-50 50 mg
EUR 1476

GPR120 Compound A

C5824-10 10 mg
EUR 293
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

GPR120 Compound A

C5824-5 5 mg
EUR 197
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

GPR120 Compound A

C5824-50 50 mg
EUR 920
Description: GPR120 Compound A is an orally active and high-affinity agonist of GPR120 [1].G-protein coupled receptor 120 is a G protein-coupled receptor which has been expressed in intestine, adipocytes, and pro-inflammatory macrophages that is activated by long chain free fatty acids.

Antibacterial compound 2

HY-101730 5mg
EUR 7984

Antibacterial compound 1

HY-101819 5mg
EUR 2198

Teijin compound 1

HY-108323 5mg
EUR 312

Antiasthmatic Compound 1

HY-U00409 1mg
EUR 849

APHA Compound 8

M45003 1 mg
EUR 284.9
Description: Ask the seller for details

dAbs scaffold protein anti-Human B5R

SDS-L073 1 mg
EUR 4496
Description: Scaffold protein

TG-SDS Buffer (Tris-Glycine-SDS) 10X Solution

A0030 4L
EUR 94.8
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TT-SDS (Tris-Tricine-SDS buffer) Premix powder

TD8135 1PK, 10L
EUR 76.1
  • Product category: Biochemicals/Biological Buffers/Common Buffers

TG-SDS, 10X (Tris-Glycine SDS), pH 8.4

UA0030 500ml
EUR 67.4
  • Product category: Biochemicals/Biological Buffers/Common Buffers

SDS Polyclonal Antibody

27842-100ul 100ul
EUR 252

SDS Polyclonal Antibody

27842-50ul 50ul
EUR 187

SDS Rabbit pAb

A12898-100ul 100 ul
EUR 308

SDS Rabbit pAb

A12898-200ul 200 ul
EUR 459

SDS Rabbit pAb

A12898-20ul 20 ul
EUR 183

SDS Rabbit pAb

A12898-50ul 50 ul
EUR 223

SDS Blocking Peptide

33R-4446 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of SDS antibody, catalog no. 70R-3762

SDS Blocking Peptide

33R-1011 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DISC1 antibody, catalog no. 70R-2399

SDS cloning plasmid

CSB-CL020926HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 657
  • Sequence: atgatgtctggagaacccctgcacgtgaagacccccatccgtgacagcatggccctgtccaaaatggccggcaccagcgtctacctcaagatggacagtgcccagccctccggctccttcaagatccggggcattgggcacttctgcaagaggtgggccaagcaaggctgtgcaca
  • Show more
Description: A cloning plasmid for the SDS gene.

101Bio SDS-Remover

P5W12 NULL
EUR 0

100G SDS Ultrapure

NAT1072 100G
EUR 93

1KG SDS Ultrapure

NAT1074 1KG
EUR 306

10% SDS Solution

S0792-050 500ml
EUR 93

10% SDS Solution

S0792-100 2X500ml
EUR 122

20% SDS Solution

S0793-050 500ml
EUR 120

20% SDS Solution

S0793-100 2X500ml
EUR 166

SurfactAway™ SDS

SA645-30 30 mL
EUR 379

SurfactAway™ SDS

SA646-250 250 mL
EUR 1389

Anti-SDS antibody

STJ114764 100 µl
EUR 277
Description: This gene encodes one of three enzymes that are involved in metabolizing serine and glycine. L-serine dehydratase converts L-serine to pyruvate and ammonia and requires pyridoxal phosphate as a cofactor. The encoded protein can also metabolize threonine to NH4+ and 2-ketobutyrate. The encoded protein is found predominantly in the liver.

Anti-SDS (1A9)

YF-MA17551 100 ug
EUR 363
Description: Mouse monoclonal to SDS

Oct 1 antibody

20R-1517 100 ug
EUR 673
Description: Rabbit polyclonal Oct 1 antibody

Oct 2 antibody

20R-1652 100 ug
EUR 673
Description: Rabbit polyclonal Oct 2 antibody

Oct 4 antibody

20R-1653 100 ug
EUR 673
Description: Rabbit polyclonal Oct 4 antibody

OCT-4 Antibody

21424-100ul 100ul
EUR 252

OCT-4 Antibody

21424-50ul 50ul
EUR 187

Oct-1 Antibody

21674-100ul 100ul
EUR 252

Oct-1 Antibody

21674-50ul 50ul
EUR 187

Oct-1 Antibody

3342-100
EUR 316

Oct-1 Antibody

3342-30T
EUR 146

Oct-2 Antibody

3575-100
EUR 338

Oct-2 Antibody

3575-30T
EUR 146

Oct-4 Antibody

3576-100
EUR 441

Oct-4 Antibody

3576-30T
EUR 146

Oct-1 Antibody

49901-100ul 100ul
EUR 333

Oct-1 Antibody

49901-50ul 50ul
EUR 239

Oct-6 Antibody

44376-100ul 100ul
EUR 252

Oct-6 Antibody

44376-50ul 50ul
EUR 187

Oct-6 Antibody

AF9136 200ul
EUR 304
Description: Oct-6 Antibody detects endogenous levels of total Oct-6.

Oct- 6 Antibody

ABF9136 100 ug
EUR 438

OCT-4/POU5F1

MO47035 100 ul
EUR 349

TEK Rabbit pAb

A0743-100ul 100 ul
EUR 308

TEK Rabbit pAb

A0743-200ul 200 ul
EUR 459

TEK Rabbit pAb

A0743-20ul 20 ul
EUR 183

TEK Rabbit pAb

A0743-50ul 50 ul
EUR 223

TEK Conjugated Antibody

C37274 100ul
EUR 397

TEK Rabbit pAb

A7222-100ul 100 ul
EUR 308

TEK Rabbit pAb

A7222-200ul 200 ul
EUR 459

TEK Rabbit pAb

A7222-20ul 20 ul
EUR 183

TEK Rabbit pAb

A7222-50ul 50 ul
EUR 223

Anti-TEK antibody

STJ25807 100 µl
EUR 277
Description: This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Anti-TEK antibody

STJ29302 100 µl
EUR 277
Description: This gene encodes a receptor that belongs to the protein tyrosine kinase Tie2 family. The encoded protein possesses a unique extracellular region that contains two immunoglobulin-like domains, three epidermal growth factor (EGF)-like domains and three fibronectin type III repeats. The ligand angiopoietin-1 binds to this receptor and mediates a signaling pathway that functions in embryonic vascular development. Mutations in this gene are associated with inherited venous malformations of the skin and mucous membranes. Alternative splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known.

Anti-TEK Antibody

STJ503257 100 µg
EUR 476

Anti-TEK Antibody

STJ503258 100 µg
EUR 476

8-hydroxy Guanosine, compound

8OHG15-N-1 1 mg
EUR 202

8-hydroxy Guanosine, compound

8OHG15-N-5 5 mg
EUR 590

PKM2 inhibitor(compound 3k)

B8217-25 25 mg
EUR 412

PKM2 inhibitor(compound 3k)

B8217-5 5 mg
EUR 168

CCT251545 analogue, Compound 51

A8739-25 25 mg
EUR 1442
Description: CCT251545 analogue, Compound 51 is a potent and selective CDK8/19 inhibitor with IC50 values of 5.1 nM and 5.6 nM, respectively [1]. Mediator complex-associated kinases CDK8 and CDK19 are involved in the regulation of multiple transcription pathways.

CCT251545 analogue, Compound 51

A8739-5 5 mg
EUR 456
Description: CCT251545 analogue, Compound 51 is a potent and selective CDK8/19 inhibitor with IC50 values of 5.1 nM and 5.6 nM, respectively [1]. Mediator complex-associated kinases CDK8 and CDK19 are involved in the regulation of multiple transcription pathways.

Arrhythmias-Targeting Compound 1

HY-101750 20mg
EUR 5683

NPS ALX Compound 4a

HY-103090 5mg
EUR 291

Cancer-Targeting Compound 1

HY-U00300 1mg
EUR 849

Neuromuscular-targeting compound 1

HY-U00310 20mg
EUR 4803

Itch-Targeting Compound 1

HY-U00361 20mg
EUR 11180

Arrhythmic-Targeting Compound 1

HY-U00393 5mg
EUR 9361

Asthma relating compound 1

HY-U00412 5mg
EUR 2846

DiscoveryProbe? Bioactive Compound Library

L1022-.1 100 uL/well(10 mM solution)
EUR 23389

DiscoveryProbe? Bioactive Compound Library

L1022-.25 250 uL/well(10 mM solution)
EUR 42042

DiscoveryProbe? Bioactive Compound Library

L1022-5 5 mg/well
EUR 54686

DiscoveryProbe? GPCR Compound Library

L1025-.1 100 uL/well(10 mM solution)
EUR 4736

DiscoveryProbe? GPCR Compound Library

L1025-.25 250 uL/well(10 mM solution)
EUR 8518

DiscoveryProbe? GPCR Compound Library

L1025-5 5 mg/well
EUR 11070

DiscoveryProbe? Epigenetics Compound Library

L1029-.1 100 uL/well(10 mM solution)
EUR 5954

DiscoveryProbe? Epigenetics Compound Library

L1029-.25 250 uL/well(10 mM solution)
EUR 10722

DiscoveryProbe? Epigenetics Compound Library

L1029-5 5 mg/well
EUR 13970

DiscoveryProbe? Autophagy Compound Library

L1031-.1 100 uL/well(10 mM solution)
EUR 11174

DiscoveryProbe? Autophagy Compound Library

L1031-.25 250 uL/well(10 mM solution)
EUR 20118

DiscoveryProbe? Autophagy Compound Library

L1031-5 5 mg/well
EUR 26150

DiscoveryProbe? Apoptosis Compound Library

L1036-.1 100 uL/well(10 mM solution)
EUR 3472

DiscoveryProbe? Apoptosis Compound Library

L1036-.25 250 uL/well(10 mM solution)
EUR 6198

DiscoveryProbe? Apoptosis Compound Library

L1036-5 5 mg/well
EUR 8054

Isoamyl alcohol (Isopentyl Alcohol, 3-Methylbutanol)

ID0278 500ml
EUR 73.93
  • Product category: Biochemicals/Solvents

Benzyl alcohol

20-abx184650
  • EUR 203.00
  • EUR 370.00
  • EUR 189.00
  • EUR 286.00
  • EUR 175.00
  • 100 g
  • 1 kg
  • 25 g
  • 500 g
  • 5 g
  • Shipped within 1-2 weeks.

Hexyl alcohol

abx186467-500ml 500 ml
EUR 244
  • Shipped within 1-2 weeks.

Methallyl alcohol

abx186496-5g 5 g
EUR 203
  • Shipped within 1-2 weeks.

Benzyl alcohol

HY-B0892 10mM/1mL
EUR 126

Tribromoethyl alcohol

HY-B1372 1g
EUR 119

Salicyl alcohol

HY-B1419 100mg
EUR 119

Patchouli alcohol

HY-N0207 20mg
EUR 211

Vanillyl alcohol

HY-N2067 100mg
EUR 108

Coniferyl alcohol

HY-N4283 5mg
EUR 108

Veratryl alcohol

HY-107858 100mg
EUR 108

Cinnamyl Alcohol

HY-Y0078 5mg
EUR 108

Cinnamyl alcohol

N1483-20 20 mg
EUR 108
Description: Extracted from Cinnamomum cassia;Suitability:Ethanol,propylene glycol;Store the product in sealed,cool and dry condition

Patchouli alcohol

N1539-20 20 mg
EUR 189
Description: Extracted from Patchouli plants;Suitability:Ethanol and ethyl ether;Store the product in sealed,cool and dry condition

Patchouli alcohol

N1539-5.1 10 mM (in 1mL DMSO)
EUR 108
Description: Extracted from Patchouli plants;Suitability:Ethanol and ethyl ether;Store the product in sealed,cool and dry condition